Incidental Mutation 'R7504:Olfr143'
ID581675
Institutional Source Beutler Lab
Gene Symbol Olfr143
Ensembl Gene ENSMUSG00000094778
Gene Nameolfactory receptor 143
SynonymsK18, GA_x6K02T2PVTD-31941084-31942025, MOR170-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7504 (G1)
Quality Score126.008
Status Validated
Chromosome9
Chromosomal Location38252774-38256549 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38254243 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 272 (K272N)
Ref Sequence ENSEMBL: ENSMUSP00000149842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093865] [ENSMUST00000213129]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093865
AA Change: K275N

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091388
Gene: ENSMUSG00000094778
AA Change: K275N

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 1e-49 PFAM
Pfam:7tm_1 44 293 1.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213129
AA Change: K272N

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 A14G probably damaging Het
6430573F11Rik A C 8: 36,512,155 N304T probably benign Het
Btn1a1 A T 13: 23,461,716 M161K probably benign Het
Camkk2 G A 5: 122,746,308 T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 L36P probably damaging Het
Dek A G 13: 47,088,035 I351T probably damaging Het
Dst T C 1: 34,201,017 Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 N300K probably damaging Het
Ephx2 A G 14: 66,101,617 Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 I198N probably damaging Het
Gm6502 G T 5: 94,317,047 V431L probably benign Het
Grid1 G T 14: 35,562,513 A738S probably damaging Het
Gsx2 G A 5: 75,076,399 probably null Het
Hc G A 2: 35,061,319 T22I not run Het
Hps1 T C 19: 42,766,720 D261G probably benign Het
Ift80 T C 3: 68,918,005 Y539C probably damaging Het
Insc G T 7: 114,791,298 probably null Het
Isg15 T C 4: 156,200,045 M9V probably damaging Het
Kalrn A G 16: 34,256,233 L695P unknown Het
Nars A C 18: 64,512,022 F52V probably benign Het
Nmt1 T G 11: 103,056,459 F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 Y290C possibly damaging Het
Olfr1495 T A 19: 13,768,732 I130N probably damaging Het
Pbx3 T C 2: 34,175,924 T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 T61S probably benign Het
Rab11fip1 T C 8: 27,152,953 E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 Y589H probably benign Het
Scara3 A G 14: 65,931,331 I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 K415E probably benign Het
Stag1 C T 9: 100,888,328 T639I probably benign Het
Sv2b A T 7: 75,136,383 F430I probably benign Het
Tenm2 C T 11: 36,139,743 C743Y probably damaging Het
Tet2 C A 3: 133,487,339 V445L probably benign Het
Tmem132c T C 5: 127,554,632 S652P probably damaging Het
Togaram1 A G 12: 64,992,617 D1155G possibly damaging Het
Traip T C 9: 107,961,544 I169T probably benign Het
Usp45 T G 4: 21,816,892 M374R possibly damaging Het
Vmn2r81 A T 10: 79,268,332 H263L probably benign Het
Wdr95 T C 5: 149,581,846 V364A probably damaging Het
Zfp128 G A 7: 12,890,478 D258N probably damaging Het
Zfp335 G A 2: 164,909,418 T76I probably benign Het
Zfp688 C A 7: 127,419,311 C214F probably damaging Het
Zfp760 T C 17: 21,722,674 S277P probably damaging Het
Other mutations in Olfr143
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02269:Olfr143 APN 9 38253936 missense possibly damaging 0.82
R0417:Olfr143 UTSW 9 38253864 missense probably benign 0.03
R1191:Olfr143 UTSW 9 38254205 missense probably damaging 0.99
R1863:Olfr143 UTSW 9 38253720 missense probably damaging 0.99
R1868:Olfr143 UTSW 9 38253690 missense probably damaging 1.00
R2252:Olfr143 UTSW 9 38253830 missense probably benign
R5128:Olfr143 UTSW 9 38253570 missense probably damaging 1.00
R7254:Olfr143 UTSW 9 38253423 missense probably benign 0.04
R7455:Olfr143 UTSW 9 38254254 missense probably damaging 0.98
R7881:Olfr143 UTSW 9 38254110 missense probably benign 0.31
Z1176:Olfr143 UTSW 9 38253852 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTTCAGCTATCATTTTATGCTGC -3'
(R):5'- TCCTCCCAGTACTCACAGAG -3'

Sequencing Primer
(F):5'- CACATGTGGGTCTCACAT -3'
(R):5'- CTCACAGAGTTACATTGCATGG -3'
Posted On2019-10-17