Incidental Mutation 'R7504:Stag1'
ID 581676
Institutional Source Beutler Lab
Gene Symbol Stag1
Ensembl Gene ENSMUSG00000037286
Gene Name stromal antigen 1
Synonyms Scc3, SA-1
MMRRC Submission 045577-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7504 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 100597798-100959375 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 100888328 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 639 (T639I)
Ref Sequence ENSEMBL: ENSMUSP00000116205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041418] [ENSMUST00000123302] [ENSMUST00000129269] [ENSMUST00000155108]
AlphaFold Q9D3E6
Predicted Effect probably benign
Transcript: ENSMUST00000041418
AA Change: T639I

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000040724
Gene: ENSMUSG00000037286
AA Change: T639I

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 157 276 1.5e-50 PFAM
SCOP:d1qbkb_ 279 850 4e-5 SMART
low complexity region 1062 1081 N/A INTRINSIC
low complexity region 1107 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123302
SMART Domains Protein: ENSMUSP00000117879
Gene: ENSMUSG00000037286

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 157 276 2.9e-51 PFAM
low complexity region 303 315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129269
AA Change: T639I

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000116205
Gene: ENSMUSG00000037286
AA Change: T639I

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:STAG 160 274 3.8e-41 PFAM
SCOP:d1qbkb_ 279 850 3e-5 SMART
low complexity region 1062 1081 N/A INTRINSIC
low complexity region 1107 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143955
SMART Domains Protein: ENSMUSP00000115460
Gene: ENSMUSG00000037286

DomainStartEndE-ValueType
low complexity region 232 251 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000120974
Gene: ENSMUSG00000037286
AA Change: T249I

DomainStartEndE-ValueType
low complexity region 673 692 N/A INTRINSIC
low complexity region 718 731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155108
SMART Domains Protein: ENSMUSP00000118952
Gene: ENSMUSG00000037286

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the SCC3 family and is expressed in the nucleus. It encodes a component of cohesin, a multisubunit protein complex that provides sister chromatid cohesion along the length of a chromosome from DNA replication through prophase and prometaphase, after which it is dissociated in preparation for segregation during anaphase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mouse embryos homozygous for a null mutation show developmental delay and die before birth. Heterozygous animals have shorter lifespan and earlier onset of tumourigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 (GRCm38) A14G probably damaging Het
6430573F11Rik A C 8: 36,512,155 (GRCm38) N304T probably benign Het
Btn1a1 A T 13: 23,461,716 (GRCm38) M161K probably benign Het
Camkk2 G A 5: 122,746,308 (GRCm38) T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 (GRCm38) D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 (GRCm38) L36P probably damaging Het
Dek A G 13: 47,088,035 (GRCm38) I351T probably damaging Het
Dst T C 1: 34,201,017 (GRCm38) Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 (GRCm38) N300K probably damaging Het
Ephx2 A G 14: 66,101,617 (GRCm38) Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 (GRCm38) I198N probably damaging Het
Gm6502 G T 5: 94,317,047 (GRCm38) V431L probably benign Het
Grid1 G T 14: 35,562,513 (GRCm38) A738S probably damaging Het
Gsx2 G A 5: 75,076,399 (GRCm38) probably null Het
Hc G A 2: 35,061,319 (GRCm38) T22I not run Het
Hps1 T C 19: 42,766,720 (GRCm38) D261G probably benign Het
Ift80 T C 3: 68,918,005 (GRCm38) Y539C probably damaging Het
Insc G T 7: 114,791,298 (GRCm38) probably null Het
Isg15 T C 4: 156,200,045 (GRCm38) M9V probably damaging Het
Kalrn A G 16: 34,256,233 (GRCm38) L695P unknown Het
Nars A C 18: 64,512,022 (GRCm38) F52V probably benign Het
Nmt1 T G 11: 103,056,459 (GRCm38) F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 (GRCm38) Y290C possibly damaging Het
Olfr143 A T 9: 38,254,243 (GRCm38) K272N possibly damaging Het
Olfr1495 T A 19: 13,768,732 (GRCm38) I130N probably damaging Het
Pbx3 T C 2: 34,175,924 (GRCm38) T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 (GRCm38) T61S probably benign Het
Rab11fip1 T C 8: 27,152,953 (GRCm38) E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 (GRCm38) Y589H probably benign Het
Scara3 A G 14: 65,931,331 (GRCm38) I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 (GRCm38) Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 (GRCm38) K415E probably benign Het
Sv2b A T 7: 75,136,383 (GRCm38) F430I probably benign Het
Tenm2 C T 11: 36,139,743 (GRCm38) C743Y probably damaging Het
Tet2 C A 3: 133,487,339 (GRCm38) V445L probably benign Het
Tmem132c T C 5: 127,554,632 (GRCm38) S652P probably damaging Het
Togaram1 A G 12: 64,992,617 (GRCm38) D1155G possibly damaging Het
Traip T C 9: 107,961,544 (GRCm38) I169T probably benign Het
Usp45 T G 4: 21,816,892 (GRCm38) M374R possibly damaging Het
Vmn2r81 A T 10: 79,268,332 (GRCm38) H263L probably benign Het
Wdr95 T C 5: 149,581,846 (GRCm38) V364A probably damaging Het
Zfp128 G A 7: 12,890,478 (GRCm38) D258N probably damaging Het
Zfp335 G A 2: 164,909,418 (GRCm38) T76I probably benign Het
Zfp688 C A 7: 127,419,311 (GRCm38) C214F probably damaging Het
Zfp760 T C 17: 21,722,674 (GRCm38) S277P probably damaging Het
Other mutations in Stag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00649:Stag1 APN 9 100,776,808 (GRCm38) missense probably damaging 1.00
IGL01010:Stag1 APN 9 100,945,933 (GRCm38) missense probably benign 0.06
IGL01012:Stag1 APN 9 100,855,859 (GRCm38) missense possibly damaging 0.47
IGL01025:Stag1 APN 9 100,951,657 (GRCm38) missense possibly damaging 0.95
IGL01307:Stag1 APN 9 100,951,788 (GRCm38) intron probably benign
IGL02149:Stag1 APN 9 100,887,389 (GRCm38) missense probably benign 0.09
IGL02608:Stag1 APN 9 100,757,769 (GRCm38) missense probably null 0.99
IGL03008:Stag1 APN 9 100,776,791 (GRCm38) missense probably damaging 1.00
IGL03210:Stag1 APN 9 100,845,076 (GRCm38) missense possibly damaging 0.63
eto_o UTSW 9 100,796,716 (GRCm38) missense probably damaging 1.00
PIT4280001:Stag1 UTSW 9 100,942,716 (GRCm38) missense possibly damaging 0.95
R0070:Stag1 UTSW 9 100,956,408 (GRCm38) missense probably null 1.00
R0070:Stag1 UTSW 9 100,956,408 (GRCm38) missense probably null 1.00
R0349:Stag1 UTSW 9 100,776,784 (GRCm38) missense probably damaging 0.98
R0479:Stag1 UTSW 9 100,928,091 (GRCm38) missense probably benign 0.00
R0531:Stag1 UTSW 9 100,954,247 (GRCm38) makesense probably null
R0962:Stag1 UTSW 9 100,796,827 (GRCm38) missense probably damaging 1.00
R0976:Stag1 UTSW 9 100,930,016 (GRCm38) critical splice donor site probably null
R0976:Stag1 UTSW 9 100,776,824 (GRCm38) missense probably damaging 0.98
R1170:Stag1 UTSW 9 100,888,453 (GRCm38) intron probably benign
R1499:Stag1 UTSW 9 100,887,373 (GRCm38) intron probably benign
R1499:Stag1 UTSW 9 100,855,832 (GRCm38) missense possibly damaging 0.77
R1644:Stag1 UTSW 9 100,880,900 (GRCm38) intron probably benign
R1747:Stag1 UTSW 9 100,888,300 (GRCm38) missense probably benign
R1799:Stag1 UTSW 9 100,953,462 (GRCm38) splice site probably null
R1807:Stag1 UTSW 9 100,908,666 (GRCm38) missense probably benign 0.34
R1978:Stag1 UTSW 9 100,888,086 (GRCm38) missense probably benign 0.03
R2029:Stag1 UTSW 9 100,786,687 (GRCm38) missense probably damaging 1.00
R2161:Stag1 UTSW 9 100,889,595 (GRCm38) missense probably damaging 1.00
R2300:Stag1 UTSW 9 100,712,500 (GRCm38) missense possibly damaging 0.92
R2327:Stag1 UTSW 9 100,786,613 (GRCm38) missense possibly damaging 0.81
R2426:Stag1 UTSW 9 100,845,116 (GRCm38) critical splice donor site probably null
R2448:Stag1 UTSW 9 100,888,409 (GRCm38) missense probably benign 0.42
R2504:Stag1 UTSW 9 100,866,210 (GRCm38) missense probably damaging 0.99
R3713:Stag1 UTSW 9 100,889,618 (GRCm38) missense probably benign 0.01
R3835:Stag1 UTSW 9 100,737,982 (GRCm38) missense probably damaging 0.97
R3862:Stag1 UTSW 9 100,944,785 (GRCm38) missense probably benign 0.02
R4398:Stag1 UTSW 9 100,956,606 (GRCm38) utr 3 prime probably benign
R4568:Stag1 UTSW 9 100,848,669 (GRCm38) missense probably damaging 1.00
R4651:Stag1 UTSW 9 100,796,716 (GRCm38) missense probably damaging 1.00
R4652:Stag1 UTSW 9 100,796,716 (GRCm38) missense probably damaging 1.00
R4653:Stag1 UTSW 9 100,796,716 (GRCm38) missense probably damaging 1.00
R4675:Stag1 UTSW 9 100,848,705 (GRCm38) missense probably damaging 1.00
R4709:Stag1 UTSW 9 100,738,039 (GRCm38) missense probably damaging 0.99
R4924:Stag1 UTSW 9 100,796,755 (GRCm38) missense possibly damaging 0.67
R5018:Stag1 UTSW 9 100,951,619 (GRCm38) missense probably benign 0.00
R5435:Stag1 UTSW 9 100,953,550 (GRCm38) missense probably benign 0.03
R5460:Stag1 UTSW 9 100,956,453 (GRCm38) splice site probably null
R5805:Stag1 UTSW 9 100,796,778 (GRCm38) missense probably damaging 1.00
R6127:Stag1 UTSW 9 100,951,697 (GRCm38) missense probably benign 0.05
R6313:Stag1 UTSW 9 100,757,733 (GRCm38) missense probably damaging 1.00
R6597:Stag1 UTSW 9 100,887,420 (GRCm38) missense probably benign 0.01
R6807:Stag1 UTSW 9 100,944,850 (GRCm38) missense probably damaging 1.00
R7099:Stag1 UTSW 9 100,944,826 (GRCm38) missense probably benign 0.02
R7167:Stag1 UTSW 9 100,945,889 (GRCm38) missense probably benign 0.05
R7395:Stag1 UTSW 9 100,796,728 (GRCm38) missense probably damaging 0.99
R7663:Stag1 UTSW 9 100,738,138 (GRCm38) missense probably damaging 0.98
R7769:Stag1 UTSW 9 100,944,827 (GRCm38) missense possibly damaging 0.86
R8245:Stag1 UTSW 9 100,929,893 (GRCm38) missense probably benign 0.01
R8343:Stag1 UTSW 9 100,757,766 (GRCm38) missense possibly damaging 0.95
R8473:Stag1 UTSW 9 100,880,787 (GRCm38) missense probably damaging 1.00
R8709:Stag1 UTSW 9 100,890,922 (GRCm38) intron probably benign
R8925:Stag1 UTSW 9 100,705,245 (GRCm38) missense possibly damaging 0.46
R8927:Stag1 UTSW 9 100,705,245 (GRCm38) missense possibly damaging 0.46
R8951:Stag1 UTSW 9 100,880,801 (GRCm38) missense probably damaging 1.00
R9138:Stag1 UTSW 9 100,947,282 (GRCm38) missense probably benign 0.01
R9233:Stag1 UTSW 9 100,929,971 (GRCm38) missense probably benign 0.00
R9246:Stag1 UTSW 9 100,888,276 (GRCm38) missense probably benign 0.00
R9419:Stag1 UTSW 9 100,929,914 (GRCm38) missense probably benign
R9442:Stag1 UTSW 9 100,954,253 (GRCm38) missense probably damaging 1.00
R9694:Stag1 UTSW 9 100,928,098 (GRCm38) missense probably benign 0.05
R9740:Stag1 UTSW 9 100,705,235 (GRCm38) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTACAGCACAGGTCGGATG -3'
(R):5'- GAATGACTCAAACAATCAGCTCTTC -3'

Sequencing Primer
(F):5'- AGGCACTCTAGAATTCTTTTGGTAG -3'
(R):5'- CAGCTCTTCTGAACAATTATTAGCC -3'
Posted On 2019-10-17