Incidental Mutation 'R7504:Traip'
ID581677
Institutional Source Beutler Lab
Gene Symbol Traip
Ensembl Gene ENSMUSG00000032586
Gene NameTRAF-interacting protein
SynonymsTrip
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_011634.3; MGI:1096377

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7504 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location107950136-107972270 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107961544 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 169 (I169T)
Ref Sequence ENSEMBL: ENSMUSP00000040001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049348] [ENSMUST00000194271]
Predicted Effect probably benign
Transcript: ENSMUST00000049348
AA Change: I169T

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000040001
Gene: ENSMUSG00000032586
AA Change: I169T

DomainStartEndE-ValueType
RING 7 49 6.68e-6 SMART
coiled coil region 70 278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194271
SMART Domains Protein: ENSMUSP00000141689
Gene: ENSMUSG00000032586

DomainStartEndE-ValueType
RING 7 49 3.2e-8 SMART
coiled coil region 54 143 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype Strain: 3764469
Lethality: E7-E9
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains an N-terminal RING finger motif and a putative coiled-coil domain. A similar murine protein interacts with TNFR-associated factor 1 (TRAF1), TNFR-associated factor 2 (TRAF2), and cylindromatosis. The interaction with TRAF2 inhibits TRAF2-mediated nuclear factor kappa-B, subunit 1 activation that is required for cell activation and protection against apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at prior to E8.5, embryonic growth retardation, decreased embryonic size, decreased cell proliferation and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(1) Gene trapped(9)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 A14G probably damaging Het
6430573F11Rik A C 8: 36,512,155 N304T probably benign Het
Btn1a1 A T 13: 23,461,716 M161K probably benign Het
Camkk2 G A 5: 122,746,308 T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 L36P probably damaging Het
Dek A G 13: 47,088,035 I351T probably damaging Het
Dst T C 1: 34,201,017 Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 N300K probably damaging Het
Ephx2 A G 14: 66,101,617 Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 I198N probably damaging Het
Gm6502 G T 5: 94,317,047 V431L probably benign Het
Grid1 G T 14: 35,562,513 A738S probably damaging Het
Gsx2 G A 5: 75,076,399 probably null Het
Hc G A 2: 35,061,319 T22I not run Het
Hps1 T C 19: 42,766,720 D261G probably benign Het
Ift80 T C 3: 68,918,005 Y539C probably damaging Het
Insc G T 7: 114,791,298 probably null Het
Isg15 T C 4: 156,200,045 M9V probably damaging Het
Kalrn A G 16: 34,256,233 L695P unknown Het
Nars A C 18: 64,512,022 F52V probably benign Het
Nmt1 T G 11: 103,056,459 F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 Y290C possibly damaging Het
Olfr143 A T 9: 38,254,243 K272N possibly damaging Het
Olfr1495 T A 19: 13,768,732 I130N probably damaging Het
Pbx3 T C 2: 34,175,924 T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 T61S probably benign Het
Rab11fip1 T C 8: 27,152,953 E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 Y589H probably benign Het
Scara3 A G 14: 65,931,331 I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 K415E probably benign Het
Stag1 C T 9: 100,888,328 T639I probably benign Het
Sv2b A T 7: 75,136,383 F430I probably benign Het
Tenm2 C T 11: 36,139,743 C743Y probably damaging Het
Tet2 C A 3: 133,487,339 V445L probably benign Het
Tmem132c T C 5: 127,554,632 S652P probably damaging Het
Togaram1 A G 12: 64,992,617 D1155G possibly damaging Het
Usp45 T G 4: 21,816,892 M374R possibly damaging Het
Vmn2r81 A T 10: 79,268,332 H263L probably benign Het
Wdr95 T C 5: 149,581,846 V364A probably damaging Het
Zfp128 G A 7: 12,890,478 D258N probably damaging Het
Zfp335 G A 2: 164,909,418 T76I probably benign Het
Zfp688 C A 7: 127,419,311 C214F probably damaging Het
Zfp760 T C 17: 21,722,674 S277P probably damaging Het
Other mutations in Traip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Traip APN 9 107970550 missense probably benign 0.15
IGL01457:Traip APN 9 107970472 missense probably benign 0.00
IGL01597:Traip APN 9 107955924 critical splice donor site probably null
IGL02197:Traip APN 9 107968737 missense possibly damaging 0.89
IGL03077:Traip APN 9 107962926 unclassified probably benign
IGL03226:Traip APN 9 107970993 missense probably damaging 0.97
BB008:Traip UTSW 9 107971042 missense probably benign 0.04
BB018:Traip UTSW 9 107971042 missense probably benign 0.04
P0016:Traip UTSW 9 107968656 missense possibly damaging 0.93
R1693:Traip UTSW 9 107970030 missense probably damaging 0.99
R2054:Traip UTSW 9 107962919 missense probably benign 0.08
R4396:Traip UTSW 9 107959487 missense probably benign 0.02
R4617:Traip UTSW 9 107970019 missense probably benign 0.00
R6151:Traip UTSW 9 107970619 critical splice donor site probably null
R6241:Traip UTSW 9 107968734 missense probably benign 0.33
R6920:Traip UTSW 9 107961041 nonsense probably null
R7177:Traip UTSW 9 107960985 missense possibly damaging 0.62
R7191:Traip UTSW 9 107970017 missense probably benign
R7931:Traip UTSW 9 107971042 missense probably benign 0.04
R7939:Traip UTSW 9 107955878 missense probably benign 0.21
R8228:Traip UTSW 9 107961066 missense probably benign 0.16
X0018:Traip UTSW 9 107961656 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTTCCTCAGAAGCATCCCTGG -3'
(R):5'- AGCCTAAGAGCTAGAGTTCACC -3'

Sequencing Primer
(F):5'- TCAGAAGCATCCCTGGAGCTG -3'
(R):5'- CTAAGAGCTAGAGTTCACCTTACG -3'
Posted On2019-10-17