Incidental Mutation 'R7504:Traip'
ID 581677
Institutional Source Beutler Lab
Gene Symbol Traip
Ensembl Gene ENSMUSG00000032586
Gene Name TRAF-interacting protein
Synonyms Trip
MMRRC Submission 045577-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7504 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 107828158-107849469 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107838743 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 169 (I169T)
Ref Sequence ENSEMBL: ENSMUSP00000040001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049348] [ENSMUST00000194271]
AlphaFold Q8VIG6
Predicted Effect probably benign
Transcript: ENSMUST00000049348
AA Change: I169T

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000040001
Gene: ENSMUSG00000032586
AA Change: I169T

DomainStartEndE-ValueType
RING 7 49 6.68e-6 SMART
coiled coil region 70 278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194271
SMART Domains Protein: ENSMUSP00000141689
Gene: ENSMUSG00000032586

DomainStartEndE-ValueType
RING 7 49 3.2e-8 SMART
coiled coil region 54 143 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains an N-terminal RING finger motif and a putative coiled-coil domain. A similar murine protein interacts with TNFR-associated factor 1 (TRAF1), TNFR-associated factor 2 (TRAF2), and cylindromatosis. The interaction with TRAF2 inhibits TRAF2-mediated nuclear factor kappa-B, subunit 1 activation that is required for cell activation and protection against apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at prior to E8.5, embryonic growth retardation, decreased embryonic size, decreased cell proliferation and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(1) Gene trapped(9)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 15,163,915 (GRCm39) A14G probably damaging Het
Btn1a1 A T 13: 23,645,886 (GRCm39) M161K probably benign Het
Camkk2 G A 5: 122,884,371 (GRCm39) T350I probably damaging Het
Cdc42bpg C A 19: 6,356,814 (GRCm39) D23E possibly damaging Het
Cdkn1a T C 17: 29,317,488 (GRCm39) L36P probably damaging Het
Dek A G 13: 47,241,511 (GRCm39) I351T probably damaging Het
Dst T C 1: 34,240,098 (GRCm39) Y1816H probably damaging Het
Efl1 T A 7: 82,332,257 (GRCm39) N300K probably damaging Het
Ephx2 A G 14: 66,339,066 (GRCm39) Y294H probably damaging Het
Fancd2 T A 6: 113,521,999 (GRCm39) I198N probably damaging Het
Grid1 G T 14: 35,284,470 (GRCm39) A738S probably damaging Het
Gsx2 G A 5: 75,237,060 (GRCm39) probably null Het
Hc G A 2: 34,951,331 (GRCm39) T22I not run Het
Hps1 T C 19: 42,755,159 (GRCm39) D261G probably benign Het
Ift80 T C 3: 68,825,338 (GRCm39) Y539C probably damaging Het
Insc G T 7: 114,390,533 (GRCm39) probably null Het
Isg15 T C 4: 156,284,502 (GRCm39) M9V probably damaging Het
Kalrn A G 16: 34,076,603 (GRCm39) L695P unknown Het
Nars1 A C 18: 64,645,093 (GRCm39) F52V probably benign Het
Nmt1 T G 11: 102,947,285 (GRCm39) F225V probably damaging Het
Or10q12 T A 19: 13,746,096 (GRCm39) I130N probably damaging Het
Or7a36 A G 10: 78,820,494 (GRCm39) Y290C possibly damaging Het
Or8c8 A T 9: 38,165,539 (GRCm39) K272N possibly damaging Het
Pbx3 T C 2: 34,065,936 (GRCm39) T385A probably damaging Het
Pcdhb11 A T 18: 37,554,852 (GRCm39) T61S probably benign Het
Pramel40 G T 5: 94,464,906 (GRCm39) V431L probably benign Het
Rab11fip1 T C 8: 27,642,981 (GRCm39) E606G possibly damaging Het
Rnf216 A G 5: 143,061,514 (GRCm39) Y589H probably benign Het
Scara3 A G 14: 66,168,780 (GRCm39) I279T possibly damaging Het
Sdk2 T A 11: 113,758,793 (GRCm39) Y477F possibly damaging Het
Secisbp2l T C 2: 125,600,091 (GRCm39) K415E probably benign Het
Stag1 C T 9: 100,770,381 (GRCm39) T639I probably benign Het
Sv2b A T 7: 74,786,131 (GRCm39) F430I probably benign Het
Tenm2 C T 11: 36,030,570 (GRCm39) C743Y probably damaging Het
Tet2 C A 3: 133,193,100 (GRCm39) V445L probably benign Het
Tmem132c T C 5: 127,631,696 (GRCm39) S652P probably damaging Het
Togaram1 A G 12: 65,039,391 (GRCm39) D1155G possibly damaging Het
Trmt9b A C 8: 36,979,309 (GRCm39) N304T probably benign Het
Usp45 T G 4: 21,816,892 (GRCm39) M374R possibly damaging Het
Vmn2r81 A T 10: 79,104,166 (GRCm39) H263L probably benign Het
Wdr95 T C 5: 149,505,311 (GRCm39) V364A probably damaging Het
Zfp128 G A 7: 12,624,405 (GRCm39) D258N probably damaging Het
Zfp335 G A 2: 164,751,338 (GRCm39) T76I probably benign Het
Zfp688 C A 7: 127,018,483 (GRCm39) C214F probably damaging Het
Zfp760 T C 17: 21,941,655 (GRCm39) S277P probably damaging Het
Other mutations in Traip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Traip APN 9 107,847,749 (GRCm39) missense probably benign 0.15
IGL01457:Traip APN 9 107,847,671 (GRCm39) missense probably benign 0.00
IGL01597:Traip APN 9 107,833,123 (GRCm39) critical splice donor site probably null
IGL02197:Traip APN 9 107,845,936 (GRCm39) missense possibly damaging 0.89
IGL03077:Traip APN 9 107,840,125 (GRCm39) unclassified probably benign
IGL03226:Traip APN 9 107,848,192 (GRCm39) missense probably damaging 0.97
BB008:Traip UTSW 9 107,848,241 (GRCm39) missense probably benign 0.04
BB018:Traip UTSW 9 107,848,241 (GRCm39) missense probably benign 0.04
P0016:Traip UTSW 9 107,845,855 (GRCm39) missense possibly damaging 0.93
R1693:Traip UTSW 9 107,847,229 (GRCm39) missense probably damaging 0.99
R2054:Traip UTSW 9 107,840,118 (GRCm39) missense probably benign 0.08
R4396:Traip UTSW 9 107,836,686 (GRCm39) missense probably benign 0.02
R4617:Traip UTSW 9 107,847,218 (GRCm39) missense probably benign 0.00
R6151:Traip UTSW 9 107,847,818 (GRCm39) critical splice donor site probably null
R6241:Traip UTSW 9 107,845,933 (GRCm39) missense probably benign 0.33
R6920:Traip UTSW 9 107,838,240 (GRCm39) nonsense probably null
R7177:Traip UTSW 9 107,838,184 (GRCm39) missense possibly damaging 0.62
R7191:Traip UTSW 9 107,847,216 (GRCm39) missense probably benign
R7931:Traip UTSW 9 107,848,241 (GRCm39) missense probably benign 0.04
R7939:Traip UTSW 9 107,833,077 (GRCm39) missense probably benign 0.21
R8228:Traip UTSW 9 107,838,265 (GRCm39) missense probably benign 0.16
R9059:Traip UTSW 9 107,840,549 (GRCm39) missense probably benign 0.01
R9511:Traip UTSW 9 107,838,785 (GRCm39) missense probably damaging 1.00
R9548:Traip UTSW 9 107,833,099 (GRCm39) missense probably damaging 1.00
X0018:Traip UTSW 9 107,838,855 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTTCCTCAGAAGCATCCCTGG -3'
(R):5'- AGCCTAAGAGCTAGAGTTCACC -3'

Sequencing Primer
(F):5'- TCAGAAGCATCCCTGGAGCTG -3'
(R):5'- CTAAGAGCTAGAGTTCACCTTACG -3'
Posted On 2019-10-17