Mutagenetix > Incidental Mutations

Incidental Mutation 'R7504:Btn1a1'

581684

Institutional Source

Beutler Lab

Gene Symbol

Btn1a1

Ensembl Gene

ENSMUSG00000000706

Gene Name

butyrophilin, subfamily 1, member A1

Synonyms

Btn

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7504 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23456992-23465901 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 23461716 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 161 (M161K)

Ref Sequence

ENSEMBL: ENSMUSP00000041013 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041674] [ENSMUST00000110434]

Predicted Effect

probably benign
Transcript: ENSMUST00000041674
AA Change: M161K

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000041013
Gene: ENSMUSG00000000706
AA Change: M161K

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
IGv	46	127	1.97e-11	SMART
IG_like	150	237	9.03e1	SMART
transmembrane domain	246	268	N/A	INTRINSIC
PRY	303	355	2.64e-27	SMART
SPRY	356	477	1.46e-39	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110434

SMART Domains

Protein: ENSMUSP00000106064
Gene: ENSMUSG00000000706

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
IGv	46	127	1.97e-11	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Butyrophilin is the major protein associated with fat droplets in the milk. It is a member of the immunoglobulin superfamily. It may have a cell surface receptor function. The human butyrophilin gene is localized in the major histocompatibility complex (MHC) class I region of 6p and may have arisen relatively recently in evolution by the shuffling of exons between 2 ancestral gene families [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display impaired lactation and abnormal lipid accumulation in the mammary gland. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012H06Rik	C	G	17: 14,943,653	A14G	probably damaging	Het
6430573F11Rik	A	C	8: 36,512,155	N304T	probably benign	Het
Camkk2	G	A	5: 122,746,308	T350I	probably damaging	Het
Cdc42bpg	C	A	19: 6,306,784	D23E	possibly damaging	Het
Cdkn1a	T	C	17: 29,098,514	L36P	probably damaging	Het
Dek	A	G	13: 47,088,035	I351T	probably damaging	Het
Dst	T	C	1: 34,201,017	Y1816H	probably damaging	Het
Efl1	T	A	7: 82,683,049	N300K	probably damaging	Het
Ephx2	A	G	14: 66,101,617	Y294H	probably damaging	Het
Fancd2	T	A	6: 113,545,038	I198N	probably damaging	Het
Gm6502	G	T	5: 94,317,047	V431L	probably benign	Het
Grid1	G	T	14: 35,562,513	A738S	probably damaging	Het
Gsx2	G	A	5: 75,076,399		probably null	Het
Hc	G	A	2: 35,061,319	T22I	not run	Het
Hps1	T	C	19: 42,766,720	D261G	probably benign	Het
Ift80	T	C	3: 68,918,005	Y539C	probably damaging	Het
Insc	G	T	7: 114,791,298		probably null	Het
Isg15	T	C	4: 156,200,045	M9V	probably damaging	Het
Kalrn	A	G	16: 34,256,233	L695P	unknown	Het
Nars	A	C	18: 64,512,022	F52V	probably benign	Het
Nmt1	T	G	11: 103,056,459	F225V	probably damaging	Het
Olfr1352	A	G	10: 78,984,660	Y290C	possibly damaging	Het
Olfr143	A	T	9: 38,254,243	K272N	possibly damaging	Het
Olfr1495	T	A	19: 13,768,732	I130N	probably damaging	Het
Pbx3	T	C	2: 34,175,924	T385A	probably damaging	Het
Pcdhb11	A	T	18: 37,421,799	T61S	probably benign	Het
Rab11fip1	T	C	8: 27,152,953	E606G	possibly damaging	Het
Rnf216	A	G	5: 143,075,759	Y589H	probably benign	Het
Scara3	A	G	14: 65,931,331	I279T	possibly damaging	Het
Sdk2	T	A	11: 113,867,967	Y477F	possibly damaging	Het
Secisbp2l	T	C	2: 125,758,171	K415E	probably benign	Het
Stag1	C	T	9: 100,888,328	T639I	probably benign	Het
Sv2b	A	T	7: 75,136,383	F430I	probably benign	Het
Tenm2	C	T	11: 36,139,743	C743Y	probably damaging	Het
Tet2	C	A	3: 133,487,339	V445L	probably benign	Het
Tmem132c	T	C	5: 127,554,632	S652P	probably damaging	Het
Togaram1	A	G	12: 64,992,617	D1155G	possibly damaging	Het
Traip	T	C	9: 107,961,544	I169T	probably benign	Het
Usp45	T	G	4: 21,816,892	M374R	possibly damaging	Het
Vmn2r81	A	T	10: 79,268,332	H263L	probably benign	Het
Wdr95	T	C	5: 149,581,846	V364A	probably damaging	Het
Zfp128	G	A	7: 12,890,478	D258N	probably damaging	Het
Zfp335	G	A	2: 164,909,418	T76I	probably benign	Het
Zfp688	C	A	7: 127,419,311	C214F	probably damaging	Het
Zfp760	T	C	17: 21,722,674	S277P	probably damaging	Het

Other mutations in Btn1a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01160:Btn1a1	APN	13	23461737	missense	possibly damaging	0.56
IGL01608:Btn1a1	APN	13	23461608	missense	probably benign	0.00
IGL02538:Btn1a1	APN	13	23459215	missense	possibly damaging	0.50
IGL02795:Btn1a1	APN	13	23460616	critical splice acceptor site	probably null
IGL02933:Btn1a1	APN	13	23460527	missense	possibly damaging	0.63
R0063:Btn1a1	UTSW	13	23465097	splice site	probably null
R0855:Btn1a1	UTSW	13	23464319	missense	probably damaging	1.00
R1754:Btn1a1	UTSW	13	23460468	missense	probably benign	0.01
R2122:Btn1a1	UTSW	13	23461521	missense	probably damaging	1.00
R3110:Btn1a1	UTSW	13	23461551	missense	possibly damaging	0.67
R3112:Btn1a1	UTSW	13	23461551	missense	possibly damaging	0.67
R3941:Btn1a1	UTSW	13	23459264	missense	probably benign	0.01
R4169:Btn1a1	UTSW	13	23465155	missense	probably benign
R4924:Btn1a1	UTSW	13	23464226	splice site	probably benign
R4927:Btn1a1	UTSW	13	23460624	splice site	probably null
R5255:Btn1a1	UTSW	13	23464154	intron	probably benign
R5554:Btn1a1	UTSW	13	23459125	missense	possibly damaging	0.55
R5726:Btn1a1	UTSW	13	23459352	missense	probably damaging	1.00
R6228:Btn1a1	UTSW	13	23464351	missense	probably damaging	0.98
R6664:Btn1a1	UTSW	13	23459320	missense	probably benign	0.00
R7117:Btn1a1	UTSW	13	23459245	missense	possibly damaging	0.91
R7150:Btn1a1	UTSW	13	23459351	missense	probably damaging	1.00
R7151:Btn1a1	UTSW	13	23459313	missense	probably damaging	1.00
R7396:Btn1a1	UTSW	13	23461498	missense	probably benign	0.01
R7874:Btn1a1	UTSW	13	23459215	missense	possibly damaging	0.50
R7878:Btn1a1	UTSW	13	23459044	missense	possibly damaging	0.86
R8271:Btn1a1	UTSW	13	23461749	missense	probably benign
R8354:Btn1a1	UTSW	13	23464250	missense	probably benign	0.00
R8454:Btn1a1	UTSW	13	23464250	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTAGTTCCACTGACCTGGTAAG -3'
(R):5'- TAGAGGAATCCTACCTAGCCCC -3'

Sequencing Primer
(F):5'- CTGGATGCAGCAGGACATGTTC -3'
(R):5'- GAATCCTACCTAGCCCCAGTCTAC -3'

Posted On

2019-10-17