Incidental Mutation 'R7504:Dek'
ID581685
Institutional Source Beutler Lab
Gene Symbol Dek
Ensembl Gene ENSMUSG00000021377
Gene NameDEK oncogene (DNA binding)
SynonymsD13H6S231E, 1810019E15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.749) question?
Stock #R7504 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location47084775-47106201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47088035 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 351 (I351T)
Ref Sequence ENSEMBL: ENSMUSP00000021807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021807] [ENSMUST00000037025] [ENSMUST00000135278] [ENSMUST00000224150]
Predicted Effect probably damaging
Transcript: ENSMUST00000021807
AA Change: I351T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021807
Gene: ENSMUSG00000021377
AA Change: I351T

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
SAP 153 187 2.97e-8 SMART
low complexity region 190 210 N/A INTRINSIC
low complexity region 231 315 N/A INTRINSIC
Pfam:DEK_C 327 379 3.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037025
SMART Domains Protein: ENSMUSP00000038373
Gene: ENSMUSG00000038080

DomainStartEndE-ValueType
Pfam:zf-CW 138 191 2.6e-13 PFAM
low complexity region 235 253 N/A INTRINSIC
Pfam:SWIRM 286 369 6e-12 PFAM
Pfam:Pyr_redox_2 368 490 3.1e-8 PFAM
Pfam:Thi4 375 446 2.2e-10 PFAM
Pfam:FAD_binding_3 388 423 4.1e-7 PFAM
Pfam:HI0933_like 389 428 1.6e-7 PFAM
Pfam:FAD_binding_2 390 428 1.6e-6 PFAM
Pfam:Pyr_redox 390 438 8e-8 PFAM
Pfam:NAD_binding_8 393 460 1.6e-13 PFAM
Pfam:Amino_oxidase 398 824 3.7e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135278
SMART Domains Protein: ENSMUSP00000121663
Gene: ENSMUSG00000021377

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
low complexity region 58 69 N/A INTRINSIC
SAP 153 187 2.97e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143518
SMART Domains Protein: ENSMUSP00000114999
Gene: ENSMUSG00000038080

DomainStartEndE-ValueType
Pfam:SWIRM 3 86 1.1e-12 PFAM
Pfam:Thi4 91 163 3.5e-10 PFAM
Pfam:FAD_binding_3 105 140 3.5e-7 PFAM
Pfam:HI0933_like 106 145 1.7e-7 PFAM
Pfam:Pyr_redox_2 106 251 1.5e-10 PFAM
Pfam:FAD_binding_2 107 150 5.7e-7 PFAM
Pfam:Pyr_redox 107 158 6.4e-8 PFAM
Pfam:Pyr_redox_3 109 288 1.2e-13 PFAM
Pfam:NAD_binding_8 110 177 2.3e-13 PFAM
Pfam:Amino_oxidase 115 181 8.6e-19 PFAM
Pfam:Amino_oxidase 178 441 4.5e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224150
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with one SAP domain. This protein binds to cruciform and superhelical DNA and induces positive supercoils into closed circular DNA, and is also involved in splice site selection during mRNA processing. Chromosomal aberrations involving this region, increased expression of this gene, and the presence of antibodies against this protein are all associated with various diseases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit delayed development of DMBA- and TPA-induced papillomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 A14G probably damaging Het
6430573F11Rik A C 8: 36,512,155 N304T probably benign Het
Btn1a1 A T 13: 23,461,716 M161K probably benign Het
Camkk2 G A 5: 122,746,308 T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 L36P probably damaging Het
Dst T C 1: 34,201,017 Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 N300K probably damaging Het
Ephx2 A G 14: 66,101,617 Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 I198N probably damaging Het
Gm6502 G T 5: 94,317,047 V431L probably benign Het
Grid1 G T 14: 35,562,513 A738S probably damaging Het
Gsx2 G A 5: 75,076,399 probably null Het
Hc G A 2: 35,061,319 T22I not run Het
Hps1 T C 19: 42,766,720 D261G probably benign Het
Ift80 T C 3: 68,918,005 Y539C probably damaging Het
Insc G T 7: 114,791,298 probably null Het
Isg15 T C 4: 156,200,045 M9V probably damaging Het
Kalrn A G 16: 34,256,233 L695P unknown Het
Nars A C 18: 64,512,022 F52V probably benign Het
Nmt1 T G 11: 103,056,459 F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 Y290C possibly damaging Het
Olfr143 A T 9: 38,254,243 K272N possibly damaging Het
Olfr1495 T A 19: 13,768,732 I130N probably damaging Het
Pbx3 T C 2: 34,175,924 T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 T61S probably benign Het
Rab11fip1 T C 8: 27,152,953 E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 Y589H probably benign Het
Scara3 A G 14: 65,931,331 I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 K415E probably benign Het
Stag1 C T 9: 100,888,328 T639I probably benign Het
Sv2b A T 7: 75,136,383 F430I probably benign Het
Tenm2 C T 11: 36,139,743 C743Y probably damaging Het
Tet2 C A 3: 133,487,339 V445L probably benign Het
Tmem132c T C 5: 127,554,632 S652P probably damaging Het
Togaram1 A G 12: 64,992,617 D1155G possibly damaging Het
Traip T C 9: 107,961,544 I169T probably benign Het
Usp45 T G 4: 21,816,892 M374R possibly damaging Het
Vmn2r81 A T 10: 79,268,332 H263L probably benign Het
Wdr95 T C 5: 149,581,846 V364A probably damaging Het
Zfp128 G A 7: 12,890,478 D258N probably damaging Het
Zfp335 G A 2: 164,909,418 T76I probably benign Het
Zfp688 C A 7: 127,419,311 C214F probably damaging Het
Zfp760 T C 17: 21,722,674 S277P probably damaging Het
Other mutations in Dek
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:Dek APN 13 47088135 missense probably benign 0.37
R1438:Dek UTSW 13 47088171 missense probably benign 0.23
R4118:Dek UTSW 13 47088600 missense probably benign 0.01
R5235:Dek UTSW 13 47086479 splice site probably null
R5847:Dek UTSW 13 47101601 unclassified probably benign
R6285:Dek UTSW 13 47099380 missense probably damaging 1.00
R6736:Dek UTSW 13 47099390 missense probably damaging 1.00
R6903:Dek UTSW 13 47098187 missense possibly damaging 0.83
R7120:Dek UTSW 13 47100183 missense unknown
R7359:Dek UTSW 13 47105589 missense unknown
R7372:Dek UTSW 13 47105577 missense unknown
R8805:Dek UTSW 13 47099454 missense unknown
RF016:Dek UTSW 13 47098186 nonsense probably null
Z1177:Dek UTSW 13 47105626 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGTTCCAGTATCCACAAGAGAGC -3'
(R):5'- GTTGGCCTTATGCTCTTTTGAAAAC -3'

Sequencing Primer
(F):5'- GTATCCACAAGAGAGCCTGGAAAC -3'
(R):5'- AAAAACTCTTCCATCTTACACCTTG -3'
Posted On2019-10-17