Incidental Mutation 'R7504:Scara3'
ID581687
Institutional Source Beutler Lab
Gene Symbol Scara3
Ensembl Gene ENSMUSG00000034463
Gene Namescavenger receptor class A, member 3
SynonymsC130058N24Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172604; MGI: 2444418

Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R7504 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location65919394-65953935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65931331 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 279 (I279T)
Ref Sequence ENSEMBL: ENSMUSP00000046525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042046]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042046
AA Change: I279T

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046525
Gene: ENSMUSG00000034463
AA Change: I279T

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
coiled coil region 117 155 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
Pfam:Collagen 455 513 3.1e-12 PFAM
Pfam:Collagen 499 558 4.2e-11 PFAM
Pfam:Collagen 544 606 2.9e-12 PFAM
Meta Mutation Damage Score 0.1843 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a macrophage scavenger receptor-like protein. This protein has been shown to deplete reactive oxygen species, and thus play an important role in protecting cells from oxidative stress. The expression of this gene is induced by oxidative stress. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 A14G probably damaging Het
6430573F11Rik A C 8: 36,512,155 N304T probably benign Het
Btn1a1 A T 13: 23,461,716 M161K probably benign Het
Camkk2 G A 5: 122,746,308 T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 L36P probably damaging Het
Dek A G 13: 47,088,035 I351T probably damaging Het
Dst T C 1: 34,201,017 Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 N300K probably damaging Het
Ephx2 A G 14: 66,101,617 Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 I198N probably damaging Het
Gm6502 G T 5: 94,317,047 V431L probably benign Het
Grid1 G T 14: 35,562,513 A738S probably damaging Het
Gsx2 G A 5: 75,076,399 probably null Het
Hc G A 2: 35,061,319 T22I not run Het
Hps1 T C 19: 42,766,720 D261G probably benign Het
Ift80 T C 3: 68,918,005 Y539C probably damaging Het
Insc G T 7: 114,791,298 probably null Het
Isg15 T C 4: 156,200,045 M9V probably damaging Het
Kalrn A G 16: 34,256,233 L695P unknown Het
Nars A C 18: 64,512,022 F52V probably benign Het
Nmt1 T G 11: 103,056,459 F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 Y290C possibly damaging Het
Olfr143 A T 9: 38,254,243 K272N possibly damaging Het
Olfr1495 T A 19: 13,768,732 I130N probably damaging Het
Pbx3 T C 2: 34,175,924 T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 T61S probably benign Het
Rab11fip1 T C 8: 27,152,953 E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 Y589H probably benign Het
Sdk2 T A 11: 113,867,967 Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 K415E probably benign Het
Stag1 C T 9: 100,888,328 T639I probably benign Het
Sv2b A T 7: 75,136,383 F430I probably benign Het
Tenm2 C T 11: 36,139,743 C743Y probably damaging Het
Tet2 C A 3: 133,487,339 V445L probably benign Het
Tmem132c T C 5: 127,554,632 S652P probably damaging Het
Togaram1 A G 12: 64,992,617 D1155G possibly damaging Het
Traip T C 9: 107,961,544 I169T probably benign Het
Usp45 T G 4: 21,816,892 M374R possibly damaging Het
Vmn2r81 A T 10: 79,268,332 H263L probably benign Het
Wdr95 T C 5: 149,581,846 V364A probably damaging Het
Zfp128 G A 7: 12,890,478 D258N probably damaging Het
Zfp335 G A 2: 164,909,418 T76I probably benign Het
Zfp688 C A 7: 127,419,311 C214F probably damaging Het
Zfp760 T C 17: 21,722,674 S277P probably damaging Het
Other mutations in Scara3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Scara3 APN 14 65933121 missense probably benign 0.01
IGL00646:Scara3 APN 14 65921156 nonsense probably null
IGL00718:Scara3 APN 14 65931427 missense possibly damaging 0.67
IGL01948:Scara3 APN 14 65930812 missense probably damaging 0.99
IGL01979:Scara3 APN 14 65930963 missense probably benign 0.01
IGL02399:Scara3 APN 14 65933110 nonsense probably null
IGL02939:Scara3 APN 14 65931656 missense probably benign 0.00
IGL02945:Scara3 APN 14 65931211 missense probably damaging 1.00
IGL03075:Scara3 APN 14 65931154 missense probably damaging 1.00
IGL03100:Scara3 APN 14 65931273 missense probably damaging 1.00
IGL03156:Scara3 APN 14 65931154 missense probably damaging 1.00
IGL03179:Scara3 APN 14 65931154 missense probably damaging 1.00
condor UTSW 14 65931202 missense probably damaging 1.00
PIT4362001:Scara3 UTSW 14 65936402 missense probably benign
R0062:Scara3 UTSW 14 65930968 missense probably damaging 1.00
R0062:Scara3 UTSW 14 65930968 missense probably damaging 1.00
R0124:Scara3 UTSW 14 65931221 missense probably benign 0.01
R0349:Scara3 UTSW 14 65931781 missense probably damaging 0.98
R1584:Scara3 UTSW 14 65921104 missense probably damaging 1.00
R4785:Scara3 UTSW 14 65953501 start codon destroyed probably null 0.06
R5336:Scara3 UTSW 14 65931038 missense probably damaging 1.00
R6307:Scara3 UTSW 14 65938261 missense probably benign 0.24
R6420:Scara3 UTSW 14 65938252 missense possibly damaging 0.92
R6610:Scara3 UTSW 14 65931221 missense probably damaging 0.97
R7159:Scara3 UTSW 14 65920780 missense probably damaging 0.98
R7208:Scara3 UTSW 14 65931266 missense possibly damaging 0.62
R7246:Scara3 UTSW 14 65931644 missense probably damaging 0.97
R7315:Scara3 UTSW 14 65931440 missense probably damaging 1.00
R7324:Scara3 UTSW 14 65931416 missense probably benign 0.03
R7497:Scara3 UTSW 14 65931202 missense probably damaging 1.00
R7554:Scara3 UTSW 14 65920850 missense possibly damaging 0.69
R8143:Scara3 UTSW 14 65931820 missense probably damaging 0.96
YA93:Scara3 UTSW 14 65930949 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCATACGTCCTTCCAGAGAC -3'
(R):5'- GCTGCTGTACACCAGATCAAC -3'

Sequencing Primer
(F):5'- AGAGACTCGAACCTTTCCACTGTG -3'
(R):5'- ACCAGATCAACTTCACGGTGGG -3'
Posted On2019-10-17