Incidental Mutation 'R7504:Kalrn'
ID 581689
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Name kalirin, RhoGEF kinase
Synonyms E530005C20Rik, LOC224126, Hapip, 2210407G14Rik
MMRRC Submission 045577-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.918) question?
Stock # R7504 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 33789443-34393647 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34076603 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 695 (L695P)
Ref Sequence ENSEMBL: ENSMUSP00000110611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000089655] [ENSMUST00000114947] [ENSMUST00000114949] [ENSMUST00000114953] [ENSMUST00000114954] [ENSMUST00000114960] [ENSMUST00000151491]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000076810
AA Change: L677P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: L677P

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000089655
AA Change: L695P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087084
Gene: ENSMUSG00000061751
AA Change: L695P

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
SEC14 38 177 2.22e-30 SMART
SPEC 191 307 5.32e-9 SMART
SPEC 313 415 1.19e-11 SMART
SPEC 418 533 1.83e0 SMART
SPEC 539 641 9.84e-13 SMART
SPEC 644 766 2.74e-2 SMART
SPEC 893 1003 1.85e-8 SMART
SPEC 1133 1235 4.7e-10 SMART
RhoGEF 1285 1455 3.6e-56 SMART
PH 1469 1582 5.24e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114947
AA Change: L54P

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110597
Gene: ENSMUSG00000061751
AA Change: L54P

DomainStartEndE-ValueType
SPEC 3 112 4.22e-3 SMART
internal_repeat_1 128 187 9.63e-6 PROSPERO
SPEC 239 349 1.85e-8 SMART
SPEC 479 581 4.7e-10 SMART
RhoGEF 631 801 3.6e-56 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114949
AA Change: L54P
SMART Domains Protein: ENSMUSP00000110599
Gene: ENSMUSG00000061751
AA Change: L54P

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 2.9e-5 PROSPERO
SPEC 252 353 8.11e-14 SMART
SPEC 483 585 4.7e-10 SMART
RhoGEF 635 805 3.6e-56 SMART
PH 819 932 5.24e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114953
AA Change: L54P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110603
Gene: ENSMUSG00000061751
AA Change: L54P

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 4.18e-5 PROSPERO
coiled coil region 217 248 N/A INTRINSIC
SPEC 252 362 1.85e-8 SMART
SPEC 492 594 4.7e-10 SMART
RhoGEF 644 814 3.6e-56 SMART
PH 828 941 5.24e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114954
AA Change: L54P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110604
Gene: ENSMUSG00000061751
AA Change: L54P

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 4.18e-5 PROSPERO
coiled coil region 217 248 N/A INTRINSIC
SPEC 252 362 1.85e-8 SMART
SPEC 492 594 4.7e-10 SMART
RhoGEF 644 814 3.6e-56 SMART
PH 828 941 5.24e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114960
AA Change: L695P
SMART Domains Protein: ENSMUSP00000110611
Gene: ENSMUSG00000061751
AA Change: L695P

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
SEC14 38 177 2.22e-30 SMART
SPEC 191 307 5.32e-9 SMART
SPEC 313 415 1.19e-11 SMART
SPEC 418 533 1.83e0 SMART
SPEC 539 641 9.84e-13 SMART
SPEC 644 766 2.74e-2 SMART
SPEC 893 994 8.11e-14 SMART
SPEC 1124 1226 4.7e-10 SMART
RhoGEF 1276 1446 3.6e-56 SMART
PH 1460 1573 5.24e-8 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: L672P

DomainStartEndE-ValueType
SEC14 16 155 2.22e-30 SMART
SPEC 169 285 5.32e-9 SMART
SPEC 291 393 1.19e-11 SMART
SPEC 396 511 1.83e0 SMART
SPEC 517 619 9.84e-13 SMART
SPEC 622 744 2.74e-2 SMART
SPEC 871 972 8.11e-14 SMART
SPEC 1102 1204 4.7e-10 SMART
RhoGEF 1254 1424 3.6e-56 SMART
PH 1438 1551 5.24e-8 SMART
SH3 1618 1679 1.23e-7 SMART
RhoGEF 1900 2070 1.47e-52 SMART
PH 2090 2195 9.87e-4 SMART
SH3 2291 2352 2.78e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151491
SMART Domains Protein: ENSMUSP00000123416
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
SEC14 26 165 2.22e-30 SMART
SPEC 179 295 5.32e-9 SMART
SPEC 301 403 1.19e-11 SMART
SPEC 640 750 1.85e-8 SMART
SPEC 880 982 4.7e-10 SMART
RhoGEF 1032 1202 3.6e-56 SMART
PH 1216 1329 5.24e-8 SMART
Meta Mutation Damage Score 0.1801 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 15,163,915 (GRCm39) A14G probably damaging Het
Btn1a1 A T 13: 23,645,886 (GRCm39) M161K probably benign Het
Camkk2 G A 5: 122,884,371 (GRCm39) T350I probably damaging Het
Cdc42bpg C A 19: 6,356,814 (GRCm39) D23E possibly damaging Het
Cdkn1a T C 17: 29,317,488 (GRCm39) L36P probably damaging Het
Dek A G 13: 47,241,511 (GRCm39) I351T probably damaging Het
Dst T C 1: 34,240,098 (GRCm39) Y1816H probably damaging Het
Efl1 T A 7: 82,332,257 (GRCm39) N300K probably damaging Het
Ephx2 A G 14: 66,339,066 (GRCm39) Y294H probably damaging Het
Fancd2 T A 6: 113,521,999 (GRCm39) I198N probably damaging Het
Grid1 G T 14: 35,284,470 (GRCm39) A738S probably damaging Het
Gsx2 G A 5: 75,237,060 (GRCm39) probably null Het
Hc G A 2: 34,951,331 (GRCm39) T22I not run Het
Hps1 T C 19: 42,755,159 (GRCm39) D261G probably benign Het
Ift80 T C 3: 68,825,338 (GRCm39) Y539C probably damaging Het
Insc G T 7: 114,390,533 (GRCm39) probably null Het
Isg15 T C 4: 156,284,502 (GRCm39) M9V probably damaging Het
Nars1 A C 18: 64,645,093 (GRCm39) F52V probably benign Het
Nmt1 T G 11: 102,947,285 (GRCm39) F225V probably damaging Het
Or10q12 T A 19: 13,746,096 (GRCm39) I130N probably damaging Het
Or7a36 A G 10: 78,820,494 (GRCm39) Y290C possibly damaging Het
Or8c8 A T 9: 38,165,539 (GRCm39) K272N possibly damaging Het
Pbx3 T C 2: 34,065,936 (GRCm39) T385A probably damaging Het
Pcdhb11 A T 18: 37,554,852 (GRCm39) T61S probably benign Het
Pramel40 G T 5: 94,464,906 (GRCm39) V431L probably benign Het
Rab11fip1 T C 8: 27,642,981 (GRCm39) E606G possibly damaging Het
Rnf216 A G 5: 143,061,514 (GRCm39) Y589H probably benign Het
Scara3 A G 14: 66,168,780 (GRCm39) I279T possibly damaging Het
Sdk2 T A 11: 113,758,793 (GRCm39) Y477F possibly damaging Het
Secisbp2l T C 2: 125,600,091 (GRCm39) K415E probably benign Het
Stag1 C T 9: 100,770,381 (GRCm39) T639I probably benign Het
Sv2b A T 7: 74,786,131 (GRCm39) F430I probably benign Het
Tenm2 C T 11: 36,030,570 (GRCm39) C743Y probably damaging Het
Tet2 C A 3: 133,193,100 (GRCm39) V445L probably benign Het
Tmem132c T C 5: 127,631,696 (GRCm39) S652P probably damaging Het
Togaram1 A G 12: 65,039,391 (GRCm39) D1155G possibly damaging Het
Traip T C 9: 107,838,743 (GRCm39) I169T probably benign Het
Trmt9b A C 8: 36,979,309 (GRCm39) N304T probably benign Het
Usp45 T G 4: 21,816,892 (GRCm39) M374R possibly damaging Het
Vmn2r81 A T 10: 79,104,166 (GRCm39) H263L probably benign Het
Wdr95 T C 5: 149,505,311 (GRCm39) V364A probably damaging Het
Zfp128 G A 7: 12,624,405 (GRCm39) D258N probably damaging Het
Zfp335 G A 2: 164,751,338 (GRCm39) T76I probably benign Het
Zfp688 C A 7: 127,018,483 (GRCm39) C214F probably damaging Het
Zfp760 T C 17: 21,941,655 (GRCm39) S277P probably damaging Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 33,996,092 (GRCm39) splice site probably benign
IGL01364:Kalrn APN 16 34,082,999 (GRCm39) missense probably damaging 1.00
IGL01510:Kalrn APN 16 34,055,700 (GRCm39) missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34,114,531 (GRCm39) missense probably damaging 1.00
IGL01934:Kalrn APN 16 34,018,882 (GRCm39) splice site probably null
IGL02059:Kalrn APN 16 34,072,711 (GRCm39) missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34,040,592 (GRCm39) missense probably damaging 1.00
IGL02306:Kalrn APN 16 34,130,897 (GRCm39) missense probably damaging 0.97
IGL02328:Kalrn APN 16 34,152,594 (GRCm39) missense probably damaging 0.98
IGL02532:Kalrn APN 16 34,181,216 (GRCm39) missense probably damaging 1.00
IGL02685:Kalrn APN 16 34,334,329 (GRCm39) nonsense probably null
IGL02696:Kalrn APN 16 34,040,484 (GRCm39) missense probably damaging 1.00
IGL02708:Kalrn APN 16 34,212,420 (GRCm39) missense probably damaging 1.00
IGL02937:Kalrn APN 16 34,040,500 (GRCm39) nonsense probably null
IGL03188:Kalrn APN 16 34,134,562 (GRCm39) missense probably benign 0.01
IGL03289:Kalrn APN 16 34,205,667 (GRCm39) missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34,134,546 (GRCm39) missense probably damaging 0.99
breeze UTSW 16 33,834,045 (GRCm39) missense
ethereal UTSW 16 33,795,805 (GRCm39) utr 3 prime probably benign
Feather UTSW 16 34,134,579 (GRCm39) missense probably damaging 0.99
Hidden UTSW 16 33,848,346 (GRCm39) missense probably damaging 1.00
Soulful UTSW 16 34,007,854 (GRCm39) nonsense probably null
G1Funyon:Kalrn UTSW 16 34,177,470 (GRCm39) missense probably benign 0.05
PIT4498001:Kalrn UTSW 16 33,851,952 (GRCm39) missense possibly damaging 0.81
R0019:Kalrn UTSW 16 34,018,884 (GRCm39) splice site probably benign
R0043:Kalrn UTSW 16 33,875,276 (GRCm39) missense probably damaging 1.00
R0052:Kalrn UTSW 16 34,177,541 (GRCm39) missense probably damaging 1.00
R0066:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R0098:Kalrn UTSW 16 33,795,989 (GRCm39) missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33,795,989 (GRCm39) missense possibly damaging 0.89
R0111:Kalrn UTSW 16 33,851,960 (GRCm39) missense probably damaging 1.00
R0113:Kalrn UTSW 16 33,870,306 (GRCm39) intron probably benign
R0183:Kalrn UTSW 16 33,991,749 (GRCm39) splice site probably null
R0422:Kalrn UTSW 16 34,134,643 (GRCm39) missense probably damaging 0.99
R0498:Kalrn UTSW 16 33,875,261 (GRCm39) missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33,814,040 (GRCm39) splice site probably benign
R0656:Kalrn UTSW 16 33,852,837 (GRCm39) missense probably damaging 1.00
R0671:Kalrn UTSW 16 33,936,778 (GRCm39) missense probably benign 0.04
R0707:Kalrn UTSW 16 33,830,951 (GRCm39) missense possibly damaging 0.88
R0709:Kalrn UTSW 16 33,855,924 (GRCm39) missense probably damaging 1.00
R0834:Kalrn UTSW 16 33,870,289 (GRCm39) missense possibly damaging 0.94
R0976:Kalrn UTSW 16 34,205,760 (GRCm39) missense probably damaging 1.00
R1297:Kalrn UTSW 16 33,836,868 (GRCm39) missense probably damaging 0.99
R1355:Kalrn UTSW 16 33,795,954 (GRCm39) missense possibly damaging 0.74
R1370:Kalrn UTSW 16 33,795,954 (GRCm39) missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33,809,173 (GRCm39) missense probably benign 0.01
R1398:Kalrn UTSW 16 34,033,190 (GRCm39) missense probably damaging 1.00
R1427:Kalrn UTSW 16 33,796,124 (GRCm39) missense probably damaging 1.00
R1458:Kalrn UTSW 16 33,994,857 (GRCm39) missense probably damaging 1.00
R1470:Kalrn UTSW 16 34,007,841 (GRCm39) missense probably damaging 1.00
R1470:Kalrn UTSW 16 34,007,841 (GRCm39) missense probably damaging 1.00
R1557:Kalrn UTSW 16 34,134,648 (GRCm39) missense possibly damaging 0.92
R1559:Kalrn UTSW 16 33,830,918 (GRCm39) missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33,796,108 (GRCm39) missense probably damaging 1.00
R1703:Kalrn UTSW 16 34,025,696 (GRCm39) missense probably damaging 1.00
R1759:Kalrn UTSW 16 34,181,320 (GRCm39) missense probably damaging 0.97
R1764:Kalrn UTSW 16 34,033,243 (GRCm39) missense probably damaging 1.00
R1824:Kalrn UTSW 16 34,114,585 (GRCm39) missense probably damaging 1.00
R1845:Kalrn UTSW 16 34,177,331 (GRCm39) missense probably damaging 0.99
R1850:Kalrn UTSW 16 33,796,293 (GRCm39) missense probably damaging 0.98
R1921:Kalrn UTSW 16 34,212,463 (GRCm39) missense probably benign 0.02
R1922:Kalrn UTSW 16 34,212,463 (GRCm39) missense probably benign 0.02
R1970:Kalrn UTSW 16 33,797,894 (GRCm39) critical splice donor site probably null
R1991:Kalrn UTSW 16 33,796,108 (GRCm39) missense probably damaging 1.00
R1992:Kalrn UTSW 16 33,796,108 (GRCm39) missense probably damaging 1.00
R2001:Kalrn UTSW 16 33,848,415 (GRCm39) missense probably damaging 1.00
R2025:Kalrn UTSW 16 34,010,106 (GRCm39) missense probably damaging 0.96
R2048:Kalrn UTSW 16 34,072,680 (GRCm39) missense probably benign 0.18
R2076:Kalrn UTSW 16 34,152,513 (GRCm39) missense probably benign 0.15
R2118:Kalrn UTSW 16 34,152,600 (GRCm39) missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34,128,094 (GRCm39) missense possibly damaging 0.82
R2145:Kalrn UTSW 16 33,829,632 (GRCm39) unclassified probably benign
R2193:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2234:Kalrn UTSW 16 33,996,632 (GRCm39) splice site probably null
R2404:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34,130,865 (GRCm39) missense probably damaging 1.00
R2903:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34,032,642 (GRCm39) missense probably benign 0.07
R3693:Kalrn UTSW 16 34,177,685 (GRCm39) missense probably damaging 1.00
R3709:Kalrn UTSW 16 34,212,400 (GRCm39) splice site probably null
R3788:Kalrn UTSW 16 34,040,610 (GRCm39) missense probably damaging 1.00
R3833:Kalrn UTSW 16 33,860,259 (GRCm39) nonsense probably null
R3871:Kalrn UTSW 16 34,024,226 (GRCm39) splice site probably null
R3934:Kalrn UTSW 16 34,130,901 (GRCm39) missense probably benign 0.34
R4033:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34,134,579 (GRCm39) missense probably damaging 0.99
R4057:Kalrn UTSW 16 34,134,579 (GRCm39) missense probably damaging 0.99
R4303:Kalrn UTSW 16 34,055,761 (GRCm39) missense probably damaging 1.00
R4402:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33,807,578 (GRCm39) missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34,212,412 (GRCm39) missense probably damaging 0.98
R4583:Kalrn UTSW 16 34,055,637 (GRCm39) missense probably damaging 1.00
R4604:Kalrn UTSW 16 34,334,296 (GRCm39) missense possibly damaging 0.46
R4620:Kalrn UTSW 16 33,849,075 (GRCm39) missense probably damaging 0.99
R4651:Kalrn UTSW 16 33,996,761 (GRCm39) missense probably damaging 1.00
R4703:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R4704:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R4705:Kalrn UTSW 16 34,024,327 (GRCm39) missense probably damaging 1.00
R4760:Kalrn UTSW 16 34,018,857 (GRCm39) missense probably damaging 1.00
R4793:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4794:Kalrn UTSW 16 33,810,180 (GRCm39) missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34,177,339 (GRCm39) missense probably damaging 1.00
R4816:Kalrn UTSW 16 34,334,389 (GRCm39) unclassified probably benign
R4888:Kalrn UTSW 16 33,991,700 (GRCm39) missense probably damaging 1.00
R4952:Kalrn UTSW 16 34,177,785 (GRCm39) splice site probably null
R5030:Kalrn UTSW 16 33,796,112 (GRCm39) missense probably benign 0.00
R5045:Kalrn UTSW 16 34,134,722 (GRCm39) nonsense probably null
R5117:Kalrn UTSW 16 33,853,971 (GRCm39) critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34,072,711 (GRCm39) missense possibly damaging 0.95
R5426:Kalrn UTSW 16 34,083,023 (GRCm39) missense probably damaging 1.00
R5432:Kalrn UTSW 16 33,873,992 (GRCm39) missense probably damaging 1.00
R5611:Kalrn UTSW 16 33,996,150 (GRCm39) missense probably damaging 1.00
R5629:Kalrn UTSW 16 33,860,304 (GRCm39) missense possibly damaging 0.77
R5635:Kalrn UTSW 16 33,834,454 (GRCm39) missense probably damaging 1.00
R5713:Kalrn UTSW 16 33,836,949 (GRCm39) missense probably benign
R5716:Kalrn UTSW 16 33,807,546 (GRCm39) missense probably benign 0.01
R5772:Kalrn UTSW 16 33,796,190 (GRCm39) missense probably damaging 1.00
R5797:Kalrn UTSW 16 34,032,619 (GRCm39) missense probably damaging 0.98
R5835:Kalrn UTSW 16 33,807,461 (GRCm39) missense probably benign 0.28
R5895:Kalrn UTSW 16 33,795,805 (GRCm39) utr 3 prime probably benign
R5924:Kalrn UTSW 16 34,064,203 (GRCm39) missense probably damaging 1.00
R5999:Kalrn UTSW 16 34,177,713 (GRCm39) missense probably damaging 1.00
R6010:Kalrn UTSW 16 33,830,950 (GRCm39) missense probably benign 0.06
R6052:Kalrn UTSW 16 34,181,255 (GRCm39) missense probably damaging 1.00
R6122:Kalrn UTSW 16 33,805,561 (GRCm39) missense possibly damaging 0.82
R6128:Kalrn UTSW 16 34,033,255 (GRCm39) missense probably damaging 0.99
R6136:Kalrn UTSW 16 34,177,481 (GRCm39) missense probably damaging 1.00
R6178:Kalrn UTSW 16 33,874,009 (GRCm39) missense possibly damaging 0.88
R6229:Kalrn UTSW 16 33,875,441 (GRCm39) missense probably damaging 1.00
R6376:Kalrn UTSW 16 33,796,361 (GRCm39) missense probably benign
R6397:Kalrn UTSW 16 33,813,355 (GRCm39) missense probably damaging 1.00
R6429:Kalrn UTSW 16 34,152,534 (GRCm39) missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34,025,672 (GRCm39) missense probably damaging 1.00
R6481:Kalrn UTSW 16 34,181,354 (GRCm39) missense probably damaging 1.00
R6597:Kalrn UTSW 16 34,003,117 (GRCm39) missense probably damaging 1.00
R6736:Kalrn UTSW 16 34,038,293 (GRCm39) missense probably damaging 1.00
R6808:Kalrn UTSW 16 33,848,346 (GRCm39) missense probably damaging 1.00
R6897:Kalrn UTSW 16 33,796,073 (GRCm39) missense probably damaging 0.99
R6955:Kalrn UTSW 16 34,040,506 (GRCm39) missense probably damaging 1.00
R7060:Kalrn UTSW 16 34,177,418 (GRCm39) missense probably damaging 0.99
R7064:Kalrn UTSW 16 34,038,261 (GRCm39) missense probably damaging 1.00
R7132:Kalrn UTSW 16 34,076,597 (GRCm39) missense unknown
R7154:Kalrn UTSW 16 34,032,527 (GRCm39) critical splice donor site probably null
R7181:Kalrn UTSW 16 33,983,447 (GRCm39) missense probably benign 0.00
R7234:Kalrn UTSW 16 33,996,792 (GRCm39) missense possibly damaging 0.63
R7235:Kalrn UTSW 16 33,996,131 (GRCm39) missense probably benign 0.18
R7563:Kalrn UTSW 16 34,212,464 (GRCm39) missense probably damaging 0.97
R7612:Kalrn UTSW 16 34,134,582 (GRCm39) missense possibly damaging 0.68
R7772:Kalrn UTSW 16 33,851,952 (GRCm39) missense probably benign 0.04
R7796:Kalrn UTSW 16 34,007,854 (GRCm39) nonsense probably null
R7867:Kalrn UTSW 16 33,810,161 (GRCm39) missense possibly damaging 0.94
R7869:Kalrn UTSW 16 33,809,217 (GRCm39) missense probably damaging 0.98
R7914:Kalrn UTSW 16 33,849,122 (GRCm39) missense probably benign
R8080:Kalrn UTSW 16 33,796,038 (GRCm39) missense possibly damaging 0.83
R8147:Kalrn UTSW 16 33,875,414 (GRCm39) missense probably benign
R8239:Kalrn UTSW 16 33,870,153 (GRCm39) missense noncoding transcript
R8281:Kalrn UTSW 16 33,855,431 (GRCm39) nonsense probably null
R8294:Kalrn UTSW 16 33,853,954 (GRCm39) missense probably benign 0.12
R8301:Kalrn UTSW 16 34,177,470 (GRCm39) missense probably benign 0.05
R8686:Kalrn UTSW 16 34,181,305 (GRCm39) missense probably damaging 1.00
R8693:Kalrn UTSW 16 33,854,884 (GRCm39) missense probably damaging 1.00
R8798:Kalrn UTSW 16 33,803,225 (GRCm39) missense possibly damaging 0.65
R8878:Kalrn UTSW 16 34,025,696 (GRCm39) missense probably damaging 1.00
R8878:Kalrn UTSW 16 34,018,830 (GRCm39) missense probably benign 0.05
R8880:Kalrn UTSW 16 34,038,305 (GRCm39) missense probably damaging 1.00
R8883:Kalrn UTSW 16 33,814,025 (GRCm39) missense probably damaging 1.00
R8887:Kalrn UTSW 16 34,047,496 (GRCm39) missense probably benign 0.22
R9048:Kalrn UTSW 16 33,854,854 (GRCm39) missense possibly damaging 0.84
R9111:Kalrn UTSW 16 34,181,371 (GRCm39) missense probably damaging 0.96
R9317:Kalrn UTSW 16 33,834,045 (GRCm39) missense
R9424:Kalrn UTSW 16 33,809,188 (GRCm39) missense probably benign 0.06
R9442:Kalrn UTSW 16 33,916,249 (GRCm39) start codon destroyed probably null 0.56
R9445:Kalrn UTSW 16 33,805,600 (GRCm39) missense probably benign 0.13
R9515:Kalrn UTSW 16 33,854,864 (GRCm39) missense probably damaging 1.00
R9516:Kalrn UTSW 16 33,854,864 (GRCm39) missense probably damaging 1.00
R9625:Kalrn UTSW 16 33,849,197 (GRCm39) critical splice acceptor site probably null
R9645:Kalrn UTSW 16 34,032,583 (GRCm39) missense probably benign 0.01
RF014:Kalrn UTSW 16 33,860,303 (GRCm39) missense probably benign 0.01
Z1177:Kalrn UTSW 16 33,855,876 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCACAAAGCAGGCTGTG -3'
(R):5'- TGGCTAGGAGCTGATTCCTCTTC -3'

Sequencing Primer
(F):5'- GCTGTGGCTGAGTCAAGAC -3'
(R):5'- AGGAGCTGATTCCTCTTCAGTTC -3'
Posted On 2019-10-17