Incidental Mutation 'R7504:1600012H06Rik'
ID 581690
Institutional Source Beutler Lab
Gene Symbol 1600012H06Rik
Ensembl Gene ENSMUSG00000050088
Gene Name RIKEN cDNA 1600012H06 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock # R7504 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 14943184-14959570 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 14943653 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glycine at position 14 (A14G)
Ref Sequence ENSEMBL: ENSMUSP00000093344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024657] [ENSMUST00000052691] [ENSMUST00000164837] [ENSMUST00000168938] [ENSMUST00000174004] [ENSMUST00000228330]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000024657
SMART Domains Protein: ENSMUSP00000024657
Gene: ENSMUSG00000023883

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
low complexity region 200 207 N/A INTRINSIC
low complexity region 281 310 N/A INTRINSIC
PHD 378 433 1.22e-8 SMART
PHD 434 478 2.44e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000052691
AA Change: A14G

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093344
Gene: ENSMUSG00000050088
AA Change: A14G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164837
AA Change: A14G

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125970
Gene: ENSMUSG00000050088
AA Change: A14G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168938
SMART Domains Protein: ENSMUSP00000125917
Gene: ENSMUSG00000023883

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
low complexity region 200 207 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174004
AA Change: A14G

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133628
Gene: ENSMUSG00000050088
AA Change: A14G

DomainStartEndE-ValueType
Pfam:UPF0669 1 185 7e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228330
Meta Mutation Damage Score 0.2290 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved, N-glycosylated protein that likely functions in the cellular response to endoplasmic reticulum stress. This protein is able to induce apoptosis in vitro in CD4+ T-cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A C 8: 36,512,155 N304T probably benign Het
Btn1a1 A T 13: 23,461,716 M161K probably benign Het
Camkk2 G A 5: 122,746,308 T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 L36P probably damaging Het
Dek A G 13: 47,088,035 I351T probably damaging Het
Dst T C 1: 34,201,017 Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 N300K probably damaging Het
Ephx2 A G 14: 66,101,617 Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 I198N probably damaging Het
Gm6502 G T 5: 94,317,047 V431L probably benign Het
Grid1 G T 14: 35,562,513 A738S probably damaging Het
Gsx2 G A 5: 75,076,399 probably null Het
Hc G A 2: 35,061,319 T22I not run Het
Hps1 T C 19: 42,766,720 D261G probably benign Het
Ift80 T C 3: 68,918,005 Y539C probably damaging Het
Insc G T 7: 114,791,298 probably null Het
Isg15 T C 4: 156,200,045 M9V probably damaging Het
Kalrn A G 16: 34,256,233 L695P unknown Het
Nars A C 18: 64,512,022 F52V probably benign Het
Nmt1 T G 11: 103,056,459 F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 Y290C possibly damaging Het
Olfr143 A T 9: 38,254,243 K272N possibly damaging Het
Olfr1495 T A 19: 13,768,732 I130N probably damaging Het
Pbx3 T C 2: 34,175,924 T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 T61S probably benign Het
Rab11fip1 T C 8: 27,152,953 E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 Y589H probably benign Het
Scara3 A G 14: 65,931,331 I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 K415E probably benign Het
Stag1 C T 9: 100,888,328 T639I probably benign Het
Sv2b A T 7: 75,136,383 F430I probably benign Het
Tenm2 C T 11: 36,139,743 C743Y probably damaging Het
Tet2 C A 3: 133,487,339 V445L probably benign Het
Tmem132c T C 5: 127,554,632 S652P probably damaging Het
Togaram1 A G 12: 64,992,617 D1155G possibly damaging Het
Traip T C 9: 107,961,544 I169T probably benign Het
Usp45 T G 4: 21,816,892 M374R possibly damaging Het
Vmn2r81 A T 10: 79,268,332 H263L probably benign Het
Wdr95 T C 5: 149,581,846 V364A probably damaging Het
Zfp128 G A 7: 12,890,478 D258N probably damaging Het
Zfp335 G A 2: 164,909,418 T76I probably benign Het
Zfp688 C A 7: 127,419,311 C214F probably damaging Het
Zfp760 T C 17: 21,722,674 S277P probably damaging Het
Other mutations in 1600012H06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:1600012H06Rik APN 17 14943919 splice site probably null
IGL01606:1600012H06Rik APN 17 14943863 missense probably damaging 1.00
IGL01845:1600012H06Rik APN 17 14944118 missense probably damaging 1.00
ANU18:1600012H06Rik UTSW 17 14943919 splice site probably null
R0556:1600012H06Rik UTSW 17 14943951 nonsense probably null
R1983:1600012H06Rik UTSW 17 14944010 missense probably damaging 0.99
R4841:1600012H06Rik UTSW 17 14943739 missense possibly damaging 0.92
R4842:1600012H06Rik UTSW 17 14943739 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTATTCTCCAGACACCTGCG -3'
(R):5'- CTCATAGTCGTCGAAGCTCG -3'

Sequencing Primer
(F):5'- AGGGGCCTGTCCTAAGGTC -3'
(R):5'- AGTGCTGTCCGACACGTACAG -3'
Posted On 2019-10-17