Incidental Mutation 'R7504:Zfp760'
ID581691
Institutional Source Beutler Lab
Gene Symbol Zfp760
Ensembl Gene ENSMUSG00000067928
Gene Namezinc finger protein 760
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R7504 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location21707741-21725636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21722674 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 277 (S277P)
Ref Sequence ENSEMBL: ENSMUSP00000073038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073312]
Predicted Effect probably damaging
Transcript: ENSMUST00000073312
AA Change: S277P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073038
Gene: ENSMUSG00000067928
AA Change: S277P

DomainStartEndE-ValueType
KRAB 8 69 3.62e-21 SMART
ZnF_C2H2 183 202 1.78e2 SMART
ZnF_C2H2 208 230 1.69e-3 SMART
ZnF_C2H2 236 258 4.54e-4 SMART
ZnF_C2H2 264 286 2.79e-4 SMART
ZnF_C2H2 292 314 1.1e-2 SMART
ZnF_C2H2 320 342 2.71e-2 SMART
ZnF_C2H2 348 370 7.9e-4 SMART
ZnF_C2H2 376 398 1.72e-4 SMART
ZnF_C2H2 404 426 1.14e0 SMART
ZnF_C2H2 432 454 4.05e-1 SMART
ZnF_C2H2 460 482 5.14e-3 SMART
ZnF_C2H2 488 510 1.18e-2 SMART
ZnF_C2H2 516 538 1.95e-3 SMART
ZnF_C2H2 544 566 1.82e-3 SMART
ZnF_C2H2 572 594 4.17e-3 SMART
ZnF_C2H2 600 622 1.04e-3 SMART
ZnF_C2H2 628 650 1.28e-3 SMART
Meta Mutation Damage Score 0.1482 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 A14G probably damaging Het
6430573F11Rik A C 8: 36,512,155 N304T probably benign Het
Btn1a1 A T 13: 23,461,716 M161K probably benign Het
Camkk2 G A 5: 122,746,308 T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 L36P probably damaging Het
Dek A G 13: 47,088,035 I351T probably damaging Het
Dst T C 1: 34,201,017 Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 N300K probably damaging Het
Ephx2 A G 14: 66,101,617 Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 I198N probably damaging Het
Gm6502 G T 5: 94,317,047 V431L probably benign Het
Grid1 G T 14: 35,562,513 A738S probably damaging Het
Gsx2 G A 5: 75,076,399 probably null Het
Hc G A 2: 35,061,319 T22I not run Het
Hps1 T C 19: 42,766,720 D261G probably benign Het
Ift80 T C 3: 68,918,005 Y539C probably damaging Het
Insc G T 7: 114,791,298 probably null Het
Isg15 T C 4: 156,200,045 M9V probably damaging Het
Kalrn A G 16: 34,256,233 L695P unknown Het
Nars A C 18: 64,512,022 F52V probably benign Het
Nmt1 T G 11: 103,056,459 F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 Y290C possibly damaging Het
Olfr143 A T 9: 38,254,243 K272N possibly damaging Het
Olfr1495 T A 19: 13,768,732 I130N probably damaging Het
Pbx3 T C 2: 34,175,924 T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 T61S probably benign Het
Rab11fip1 T C 8: 27,152,953 E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 Y589H probably benign Het
Scara3 A G 14: 65,931,331 I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 K415E probably benign Het
Stag1 C T 9: 100,888,328 T639I probably benign Het
Sv2b A T 7: 75,136,383 F430I probably benign Het
Tenm2 C T 11: 36,139,743 C743Y probably damaging Het
Tet2 C A 3: 133,487,339 V445L probably benign Het
Tmem132c T C 5: 127,554,632 S652P probably damaging Het
Togaram1 A G 12: 64,992,617 D1155G possibly damaging Het
Traip T C 9: 107,961,544 I169T probably benign Het
Usp45 T G 4: 21,816,892 M374R possibly damaging Het
Vmn2r81 A T 10: 79,268,332 H263L probably benign Het
Wdr95 T C 5: 149,581,846 V364A probably damaging Het
Zfp128 G A 7: 12,890,478 D258N probably damaging Het
Zfp335 G A 2: 164,909,418 T76I probably benign Het
Zfp688 C A 7: 127,419,311 C214F probably damaging Het
Other mutations in Zfp760
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Zfp760 APN 17 21723476 missense possibly damaging 0.75
IGL00862:Zfp760 APN 17 21722284 missense probably benign 0.00
IGL02198:Zfp760 APN 17 21722212 missense probably benign 0.00
R0478:Zfp760 UTSW 17 21722014 nonsense probably null
R0835:Zfp760 UTSW 17 21723578 missense possibly damaging 0.63
R1191:Zfp760 UTSW 17 21723305 missense probably damaging 1.00
R1760:Zfp760 UTSW 17 21722330 missense probably damaging 1.00
R2698:Zfp760 UTSW 17 21720954 missense probably damaging 0.99
R3722:Zfp760 UTSW 17 21722162 missense probably damaging 1.00
R4561:Zfp760 UTSW 17 21723667 missense probably benign 0.00
R4700:Zfp760 UTSW 17 21722407 missense probably benign 0.01
R4859:Zfp760 UTSW 17 21723530 missense probably damaging 0.97
R4859:Zfp760 UTSW 17 21723535 nonsense probably null
R4897:Zfp760 UTSW 17 21723248 missense probably benign 0.02
R6675:Zfp760 UTSW 17 21723010 missense possibly damaging 0.92
R7286:Zfp760 UTSW 17 21722779 missense probably benign 0.04
R7336:Zfp760 UTSW 17 21723833 missense unknown
R7356:Zfp760 UTSW 17 21722620 missense probably benign
R7369:Zfp760 UTSW 17 21723233 missense probably benign 0.00
R7553:Zfp760 UTSW 17 21722891 missense possibly damaging 0.82
R7577:Zfp760 UTSW 17 21722261 nonsense probably null
R7579:Zfp760 UTSW 17 21722926 missense possibly damaging 0.93
R7608:Zfp760 UTSW 17 21722816 missense probably benign 0.00
R7973:Zfp760 UTSW 17 21722103 missense probably benign 0.00
R8078:Zfp760 UTSW 17 21723455 missense probably benign 0.27
R8332:Zfp760 UTSW 17 21723320 missense probably damaging 0.99
R8750:Zfp760 UTSW 17 21722375 missense possibly damaging 0.56
X0057:Zfp760 UTSW 17 21723682 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GTGGCTCTACACACAGACTTGT -3'
(R):5'- TTTTAAGGCCTGACAACCAATGGAA -3'

Sequencing Primer
(F):5'- TAGGAGTTGCTCAAGCCTCAGTAC -3'
(R):5'- GGAAGAACTTACCACATTCTTTGCAC -3'
Posted On2019-10-17