Incidental Mutation 'R7504:Zfp760'
ID 581691
Institutional Source Beutler Lab
Gene Symbol Zfp760
Ensembl Gene ENSMUSG00000067928
Gene Name zinc finger protein 760
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock # R7504 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 21707741-21725636 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21722674 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 277 (S277P)
Ref Sequence ENSEMBL: ENSMUSP00000073038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073312]
AlphaFold E9QAF5
Predicted Effect probably damaging
Transcript: ENSMUST00000073312
AA Change: S277P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073038
Gene: ENSMUSG00000067928
AA Change: S277P

DomainStartEndE-ValueType
KRAB 8 69 3.62e-21 SMART
ZnF_C2H2 183 202 1.78e2 SMART
ZnF_C2H2 208 230 1.69e-3 SMART
ZnF_C2H2 236 258 4.54e-4 SMART
ZnF_C2H2 264 286 2.79e-4 SMART
ZnF_C2H2 292 314 1.1e-2 SMART
ZnF_C2H2 320 342 2.71e-2 SMART
ZnF_C2H2 348 370 7.9e-4 SMART
ZnF_C2H2 376 398 1.72e-4 SMART
ZnF_C2H2 404 426 1.14e0 SMART
ZnF_C2H2 432 454 4.05e-1 SMART
ZnF_C2H2 460 482 5.14e-3 SMART
ZnF_C2H2 488 510 1.18e-2 SMART
ZnF_C2H2 516 538 1.95e-3 SMART
ZnF_C2H2 544 566 1.82e-3 SMART
ZnF_C2H2 572 594 4.17e-3 SMART
ZnF_C2H2 600 622 1.04e-3 SMART
ZnF_C2H2 628 650 1.28e-3 SMART
Meta Mutation Damage Score 0.1482 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C G 17: 14,943,653 A14G probably damaging Het
6430573F11Rik A C 8: 36,512,155 N304T probably benign Het
Btn1a1 A T 13: 23,461,716 M161K probably benign Het
Camkk2 G A 5: 122,746,308 T350I probably damaging Het
Cdc42bpg C A 19: 6,306,784 D23E possibly damaging Het
Cdkn1a T C 17: 29,098,514 L36P probably damaging Het
Dek A G 13: 47,088,035 I351T probably damaging Het
Dst T C 1: 34,201,017 Y1816H probably damaging Het
Efl1 T A 7: 82,683,049 N300K probably damaging Het
Ephx2 A G 14: 66,101,617 Y294H probably damaging Het
Fancd2 T A 6: 113,545,038 I198N probably damaging Het
Gm6502 G T 5: 94,317,047 V431L probably benign Het
Grid1 G T 14: 35,562,513 A738S probably damaging Het
Gsx2 G A 5: 75,076,399 probably null Het
Hc G A 2: 35,061,319 T22I not run Het
Hps1 T C 19: 42,766,720 D261G probably benign Het
Ift80 T C 3: 68,918,005 Y539C probably damaging Het
Insc G T 7: 114,791,298 probably null Het
Isg15 T C 4: 156,200,045 M9V probably damaging Het
Kalrn A G 16: 34,256,233 L695P unknown Het
Nars A C 18: 64,512,022 F52V probably benign Het
Nmt1 T G 11: 103,056,459 F225V probably damaging Het
Olfr1352 A G 10: 78,984,660 Y290C possibly damaging Het
Olfr143 A T 9: 38,254,243 K272N possibly damaging Het
Olfr1495 T A 19: 13,768,732 I130N probably damaging Het
Pbx3 T C 2: 34,175,924 T385A probably damaging Het
Pcdhb11 A T 18: 37,421,799 T61S probably benign Het
Rab11fip1 T C 8: 27,152,953 E606G possibly damaging Het
Rnf216 A G 5: 143,075,759 Y589H probably benign Het
Scara3 A G 14: 65,931,331 I279T possibly damaging Het
Sdk2 T A 11: 113,867,967 Y477F possibly damaging Het
Secisbp2l T C 2: 125,758,171 K415E probably benign Het
Stag1 C T 9: 100,888,328 T639I probably benign Het
Sv2b A T 7: 75,136,383 F430I probably benign Het
Tenm2 C T 11: 36,139,743 C743Y probably damaging Het
Tet2 C A 3: 133,487,339 V445L probably benign Het
Tmem132c T C 5: 127,554,632 S652P probably damaging Het
Togaram1 A G 12: 64,992,617 D1155G possibly damaging Het
Traip T C 9: 107,961,544 I169T probably benign Het
Usp45 T G 4: 21,816,892 M374R possibly damaging Het
Vmn2r81 A T 10: 79,268,332 H263L probably benign Het
Wdr95 T C 5: 149,581,846 V364A probably damaging Het
Zfp128 G A 7: 12,890,478 D258N probably damaging Het
Zfp335 G A 2: 164,909,418 T76I probably benign Het
Zfp688 C A 7: 127,419,311 C214F probably damaging Het
Other mutations in Zfp760
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Zfp760 APN 17 21723476 missense possibly damaging 0.75
IGL00862:Zfp760 APN 17 21722284 missense probably benign 0.00
IGL02198:Zfp760 APN 17 21722212 missense probably benign 0.00
R0478:Zfp760 UTSW 17 21722014 nonsense probably null
R0835:Zfp760 UTSW 17 21723578 missense possibly damaging 0.63
R1191:Zfp760 UTSW 17 21723305 missense probably damaging 1.00
R1760:Zfp760 UTSW 17 21722330 missense probably damaging 1.00
R2698:Zfp760 UTSW 17 21720954 missense probably damaging 0.99
R3722:Zfp760 UTSW 17 21722162 missense probably damaging 1.00
R4561:Zfp760 UTSW 17 21723667 missense probably benign 0.00
R4700:Zfp760 UTSW 17 21722407 missense probably benign 0.01
R4859:Zfp760 UTSW 17 21723530 missense probably damaging 0.97
R4859:Zfp760 UTSW 17 21723535 nonsense probably null
R4897:Zfp760 UTSW 17 21723248 missense probably benign 0.02
R6675:Zfp760 UTSW 17 21723010 missense possibly damaging 0.92
R7286:Zfp760 UTSW 17 21722779 missense probably benign 0.04
R7336:Zfp760 UTSW 17 21723833 missense unknown
R7356:Zfp760 UTSW 17 21722620 missense probably benign
R7369:Zfp760 UTSW 17 21723233 missense probably benign 0.00
R7553:Zfp760 UTSW 17 21722891 missense possibly damaging 0.82
R7577:Zfp760 UTSW 17 21722261 nonsense probably null
R7579:Zfp760 UTSW 17 21722926 missense possibly damaging 0.93
R7608:Zfp760 UTSW 17 21722816 missense probably benign 0.00
R7973:Zfp760 UTSW 17 21722103 missense probably benign 0.00
R8078:Zfp760 UTSW 17 21723455 missense probably benign 0.27
R8332:Zfp760 UTSW 17 21723320 missense probably damaging 0.99
R8750:Zfp760 UTSW 17 21722375 missense possibly damaging 0.56
R9094:Zfp760 UTSW 17 21722951 missense possibly damaging 0.86
R9264:Zfp760 UTSW 17 21723682 missense possibly damaging 0.80
R9372:Zfp760 UTSW 17 21722054 missense probably benign 0.00
R9520:Zfp760 UTSW 17 21722055 missense probably benign 0.00
R9564:Zfp760 UTSW 17 21723291 missense possibly damaging 0.94
X0057:Zfp760 UTSW 17 21723682 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GTGGCTCTACACACAGACTTGT -3'
(R):5'- TTTTAAGGCCTGACAACCAATGGAA -3'

Sequencing Primer
(F):5'- TAGGAGTTGCTCAAGCCTCAGTAC -3'
(R):5'- GGAAGAACTTACCACATTCTTTGCAC -3'
Posted On 2019-10-17