Mutagenetix > Incidental Mutation

Incidental Mutation 'R7504:Cdc42bpg'

581695

Institutional Source

Beutler Lab

Gene Symbol

Cdc42bpg

Ensembl Gene

ENSMUSG00000024769

Gene Name

CDC42 binding protein kinase gamma (DMPK-like)

Synonyms

MRCKgamma

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.257) question?

Stock #

R7504 (G1)

Quality Score

155.008

Status

Validated

Chromosome

Chromosomal Location

6306456-6325652 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 6306784 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 23 (D23E)

Ref Sequence

ENSEMBL: ENSMUSP00000025681 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025681]

AlphaFold

Q80UW5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025681
AA Change: D23E

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000025681
Gene: ENSMUSG00000024769
AA Change: D23E

Domain	Start	End	E-Value	Type
low complexity region	21	31	N/A	INTRINSIC
S_TKc	71	337	1.63e-87	SMART
S_TK_X	338	400	7.85e-12	SMART
coiled coil region	444	551	N/A	INTRINSIC
coiled coil region	630	675	N/A	INTRINSIC
Pfam:DMPK_coil	743	801	4.6e-21	PFAM
low complexity region	861	873	N/A	INTRINSIC
C1	878	926	1.78e-7	SMART
PH	947	1067	3.57e-10	SMART
Pfam:CNH	1096	1362	7.5e-56	PFAM
low complexity region	1401	1412	N/A	INTRINSIC
low complexity region	1535	1551	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (43/43)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012H06Rik	C	G	17: 14,943,653	A14G	probably damaging	Het
6430573F11Rik	A	C	8: 36,512,155	N304T	probably benign	Het
Btn1a1	A	T	13: 23,461,716	M161K	probably benign	Het
Camkk2	G	A	5: 122,746,308	T350I	probably damaging	Het
Cdkn1a	T	C	17: 29,098,514	L36P	probably damaging	Het
Dek	A	G	13: 47,088,035	I351T	probably damaging	Het
Dst	T	C	1: 34,201,017	Y1816H	probably damaging	Het
Efl1	T	A	7: 82,683,049	N300K	probably damaging	Het
Ephx2	A	G	14: 66,101,617	Y294H	probably damaging	Het
Fancd2	T	A	6: 113,545,038	I198N	probably damaging	Het
Gm6502	G	T	5: 94,317,047	V431L	probably benign	Het
Grid1	G	T	14: 35,562,513	A738S	probably damaging	Het
Gsx2	G	A	5: 75,076,399		probably null	Het
Hc	G	A	2: 35,061,319	T22I	not run	Het
Hps1	T	C	19: 42,766,720	D261G	probably benign	Het
Ift80	T	C	3: 68,918,005	Y539C	probably damaging	Het
Insc	G	T	7: 114,791,298		probably null	Het
Isg15	T	C	4: 156,200,045	M9V	probably damaging	Het
Kalrn	A	G	16: 34,256,233	L695P	unknown	Het
Nars	A	C	18: 64,512,022	F52V	probably benign	Het
Nmt1	T	G	11: 103,056,459	F225V	probably damaging	Het
Olfr1352	A	G	10: 78,984,660	Y290C	possibly damaging	Het
Olfr143	A	T	9: 38,254,243	K272N	possibly damaging	Het
Olfr1495	T	A	19: 13,768,732	I130N	probably damaging	Het
Pbx3	T	C	2: 34,175,924	T385A	probably damaging	Het
Pcdhb11	A	T	18: 37,421,799	T61S	probably benign	Het
Rab11fip1	T	C	8: 27,152,953	E606G	possibly damaging	Het
Rnf216	A	G	5: 143,075,759	Y589H	probably benign	Het
Scara3	A	G	14: 65,931,331	I279T	possibly damaging	Het
Sdk2	T	A	11: 113,867,967	Y477F	possibly damaging	Het
Secisbp2l	T	C	2: 125,758,171	K415E	probably benign	Het
Stag1	C	T	9: 100,888,328	T639I	probably benign	Het
Sv2b	A	T	7: 75,136,383	F430I	probably benign	Het
Tenm2	C	T	11: 36,139,743	C743Y	probably damaging	Het
Tet2	C	A	3: 133,487,339	V445L	probably benign	Het
Tmem132c	T	C	5: 127,554,632	S652P	probably damaging	Het
Togaram1	A	G	12: 64,992,617	D1155G	possibly damaging	Het
Traip	T	C	9: 107,961,544	I169T	probably benign	Het
Usp45	T	G	4: 21,816,892	M374R	possibly damaging	Het
Vmn2r81	A	T	10: 79,268,332	H263L	probably benign	Het
Wdr95	T	C	5: 149,581,846	V364A	probably damaging	Het
Zfp128	G	A	7: 12,890,478	D258N	probably damaging	Het
Zfp335	G	A	2: 164,909,418	T76I	probably benign	Het
Zfp688	C	A	7: 127,419,311	C214F	probably damaging	Het
Zfp760	T	C	17: 21,722,674	S277P	probably damaging	Het

Other mutations in Cdc42bpg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Cdc42bpg	APN	19	6312205	splice site	probably benign
IGL01415:Cdc42bpg	APN	19	6310851	missense	probably damaging	1.00
IGL01517:Cdc42bpg	APN	19	6318437	missense	probably damaging	1.00
IGL01585:Cdc42bpg	APN	19	6320432	missense	possibly damaging	0.93
IGL01743:Cdc42bpg	APN	19	6309823	critical splice donor site	probably null
IGL01930:Cdc42bpg	APN	19	6311368	missense	probably damaging	1.00
IGL02092:Cdc42bpg	APN	19	6316826	splice site	probably benign
IGL02355:Cdc42bpg	APN	19	6310809	missense	possibly damaging	0.93
IGL02362:Cdc42bpg	APN	19	6310809	missense	possibly damaging	0.93
IGL02498:Cdc42bpg	APN	19	6322793	missense	probably benign
IGL03004:Cdc42bpg	APN	19	6311383	missense	probably benign	0.38
IGL03037:Cdc42bpg	APN	19	6311200	missense	probably damaging	1.00
PIT1430001:Cdc42bpg	UTSW	19	6322552	splice site	probably null
R0304:Cdc42bpg	UTSW	19	6317248	missense	probably damaging	0.99
R0367:Cdc42bpg	UTSW	19	6311395	missense	probably damaging	1.00
R0412:Cdc42bpg	UTSW	19	6313457	missense	probably damaging	1.00
R0742:Cdc42bpg	UTSW	19	6318575	critical splice donor site	probably null
R1026:Cdc42bpg	UTSW	19	6317187	missense	probably damaging	1.00
R1056:Cdc42bpg	UTSW	19	6314021	missense	probably benign	0.10
R1065:Cdc42bpg	UTSW	19	6322826	missense	probably damaging	1.00
R1476:Cdc42bpg	UTSW	19	6313782	missense	probably damaging	0.99
R1854:Cdc42bpg	UTSW	19	6320807	missense	possibly damaging	0.67
R1936:Cdc42bpg	UTSW	19	6310309	missense	probably damaging	1.00
R1962:Cdc42bpg	UTSW	19	6306855	missense	probably damaging	1.00
R2070:Cdc42bpg	UTSW	19	6320488	missense	probably damaging	1.00
R2167:Cdc42bpg	UTSW	19	6317677	missense	probably damaging	1.00
R3826:Cdc42bpg	UTSW	19	6317645	missense	probably damaging	0.99
R3829:Cdc42bpg	UTSW	19	6317645	missense	probably damaging	0.99
R4190:Cdc42bpg	UTSW	19	6321681	missense	probably damaging	1.00
R4249:Cdc42bpg	UTSW	19	6315266	missense	possibly damaging	0.65
R4499:Cdc42bpg	UTSW	19	6320555	missense	possibly damaging	0.69
R4731:Cdc42bpg	UTSW	19	6311191	missense	probably damaging	1.00
R4732:Cdc42bpg	UTSW	19	6311191	missense	probably damaging	1.00
R4733:Cdc42bpg	UTSW	19	6311191	missense	probably damaging	1.00
R4797:Cdc42bpg	UTSW	19	6320447	missense	probably damaging	1.00
R4831:Cdc42bpg	UTSW	19	6311335	missense	probably damaging	0.97
R4984:Cdc42bpg	UTSW	19	6316223	missense	possibly damaging	0.88
R5092:Cdc42bpg	UTSW	19	6313220	missense	probably benign	0.01
R5135:Cdc42bpg	UTSW	19	6320618	missense	probably damaging	1.00
R5183:Cdc42bpg	UTSW	19	6321805	intron	probably benign
R5208:Cdc42bpg	UTSW	19	6321720	missense	probably benign	0.01
R5240:Cdc42bpg	UTSW	19	6315899	missense	probably damaging	1.00
R5475:Cdc42bpg	UTSW	19	6311071	missense	probably damaging	0.99
R5703:Cdc42bpg	UTSW	19	6322673	missense	possibly damaging	0.87
R5876:Cdc42bpg	UTSW	19	6310815	missense	probably damaging	1.00
R6024:Cdc42bpg	UTSW	19	6317496	missense	probably damaging	1.00
R6266:Cdc42bpg	UTSW	19	6311473	missense	probably damaging	1.00
R6450:Cdc42bpg	UTSW	19	6314488	splice site	probably null
R6493:Cdc42bpg	UTSW	19	6318455	missense	probably damaging	0.96
R6983:Cdc42bpg	UTSW	19	6321668	missense	probably damaging	1.00
R7080:Cdc42bpg	UTSW	19	6315189	missense	probably damaging	0.97
R7125:Cdc42bpg	UTSW	19	6322291	missense	probably damaging	1.00
R7183:Cdc42bpg	UTSW	19	6310797	missense	probably damaging	1.00
R7317:Cdc42bpg	UTSW	19	6314504	missense	probably benign	0.11
R7426:Cdc42bpg	UTSW	19	6318398	missense	probably damaging	1.00
R7530:Cdc42bpg	UTSW	19	6322275	missense	probably benign	0.21
R7530:Cdc42bpg	UTSW	19	6322276	missense	probably benign	0.12
R7739:Cdc42bpg	UTSW	19	6310815	missense	probably damaging	1.00
R7903:Cdc42bpg	UTSW	19	6313469	missense	possibly damaging	0.94
R8186:Cdc42bpg	UTSW	19	6306865	missense	probably damaging	1.00
R8331:Cdc42bpg	UTSW	19	6313447	missense	probably benign	0.08
R8870:Cdc42bpg	UTSW	19	6314520	missense	possibly damaging	0.94
R9014:Cdc42bpg	UTSW	19	6322259	missense	possibly damaging	0.88
R9256:Cdc42bpg	UTSW	19	6311037	missense	probably damaging	1.00
R9263:Cdc42bpg	UTSW	19	6322119	missense	probably damaging	1.00
R9343:Cdc42bpg	UTSW	19	6314523	missense	probably damaging	1.00
R9423:Cdc42bpg	UTSW	19	6313299	missense	probably damaging	1.00
R9565:Cdc42bpg	UTSW	19	6320666	missense	probably damaging	1.00
R9667:Cdc42bpg	UTSW	19	6320085	missense	probably benign	0.00
Z1177:Cdc42bpg	UTSW	19	6309746	missense	probably damaging	1.00
Z1177:Cdc42bpg	UTSW	19	6314522	missense	possibly damaging	0.94
Z1177:Cdc42bpg	UTSW	19	6314523	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTACTTTTCGTGGCCCGC -3'
(R):5'- AATATGCCACTCCCGGGAAAAG -3'

Sequencing Primer
(F):5'- TCCCACTTCCTGGACGAG -3'
(R):5'- ACTCCCGGGAAAAGGTCTG -3'

Posted On

2019-10-17