Incidental Mutation 'R7505:Tnfrsf8'
ID581717
Institutional Source Beutler Lab
Gene Symbol Tnfrsf8
Ensembl Gene ENSMUSG00000028602
Gene Nametumor necrosis factor receptor superfamily, member 8
SynonymsCD30
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R7505 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location145267137-145315164 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 145269115 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 458 (D458A)
Ref Sequence ENSEMBL: ENSMUSP00000030339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030339] [ENSMUST00000123027]
Predicted Effect probably damaging
Transcript: ENSMUST00000030339
AA Change: D458A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030339
Gene: ENSMUSG00000028602
AA Change: D458A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
TNFR 29 65 2.33e0 SMART
TNFR 69 105 5.51e-7 SMART
TNFR 107 146 2.87e-5 SMART
low complexity region 149 161 N/A INTRINSIC
transmembrane domain 288 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123027
SMART Domains Protein: ENSMUSP00000118714
Gene: ENSMUSG00000028602

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
TNFR 29 65 2.33e0 SMART
TNFR 69 105 5.51e-7 SMART
TNFR 107 146 2.87e-5 SMART
low complexity region 149 161 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is expressed by activated, but not by resting, T and B cells. TRAF2 and TRAF5 can interact with this receptor, and mediate the signal transduction that leads to the activation of NF-kappaB. This receptor is a positive regulator of apoptosis, and also has been shown to limit the proliferative potential of autoreactive CD8 effector T cells and protect the body against autoimmunity. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display an enlarged thymus, impaired activation-induced death of double-positive thymocytes after CD3 cross-linking, and decreased susceptibility to graft versus host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T A 15: 91,149,057 N719Y possibly damaging Het
Adamts2 T C 11: 50,796,520 I1058T probably benign Het
Alb T A 5: 90,469,509 Y356N probably damaging Het
Ankrd52 A G 10: 128,390,055 N971D probably damaging Het
Atp6v1c2 A G 12: 17,297,723 probably null Het
Atp6v1h A T 1: 5,124,338 I247L probably benign Het
Cacna1s C T 1: 136,085,449 R593* probably null Het
Cacna2d3 C T 14: 29,045,544 probably null Het
Cdh15 G A 8: 122,848,492 G2D probably benign Het
Cebpe G T 14: 54,710,656 N243K probably damaging Het
Celf2 A T 2: 6,624,700 M136K probably damaging Het
Cep290 A G 10: 100,516,265 I778V probably benign Het
Col22a1 A T 15: 71,799,399 C1592* probably null Het
Cpne2 A T 8: 94,548,466 N34I possibly damaging Het
Cps1 A G 1: 67,180,081 N860S probably benign Het
Disp2 T G 2: 118,791,088 L767R probably damaging Het
Evpl A G 11: 116,226,987 probably null Het
F7 A T 8: 13,028,745 N59Y possibly damaging Het
Fam198a G C 9: 121,976,417 G425R probably benign Het
Fam98a A T 17: 75,538,238 H504Q unknown Het
Fbxo4 G A 15: 3,971,421 R270C probably benign Het
Fcgbp T C 7: 28,089,674 V555A probably damaging Het
Fgf4 T C 7: 144,861,761 V86A possibly damaging Het
Fpgt G T 3: 155,086,776 A538D possibly damaging Het
Gars A G 6: 55,052,177 T181A probably benign Het
Gbx2 A G 1: 89,928,733 S312P probably benign Het
Gm13101 C T 4: 143,964,986 C389Y probably benign Het
Gm21319 A T 12: 87,773,500 N96K probably benign Het
Gm29735 C T 7: 142,156,590 C175Y unknown Het
Gm7995 A G 14: 42,310,357 T49A Het
Gm8879 T A 5: 11,131,168 Y141N possibly damaging Het
Hnrnpk A G 13: 58,399,969 M27T probably benign Het
Idh3b A G 2: 130,284,227 S20P probably benign Het
Idh3b G C 2: 130,284,233 R18G probably benign Het
Ighg2b T A 12: 113,304,980 T354S Het
Lrfn2 T A 17: 49,096,451 M534K probably benign Het
Mcpt8 G A 14: 56,083,091 A127V probably benign Het
Msi2 A T 11: 88,413,917 N176K possibly damaging Het
Mtr G T 13: 12,221,476 D621E probably benign Het
Nlrp5 T A 7: 23,407,500 I63N probably benign Het
Nol6 T C 4: 41,120,352 D455G probably damaging Het
Nrde2 A T 12: 100,132,498 S637T probably benign Het
Ntn4 G T 10: 93,707,284 G291W probably damaging Het
Olfr1425 T A 19: 12,074,605 E9V possibly damaging Het
Olfr61 C A 7: 140,638,052 T117K probably damaging Het
Otof T A 5: 30,371,020 T1865S probably benign Het
Papd7 G T 13: 69,506,928 P476T probably damaging Het
Plec A T 15: 76,181,194 S1559T unknown Het
Plekhm1 C T 11: 103,380,029 probably null Het
Plin4 T A 17: 56,109,357 Q49L possibly damaging Het
Polrmt A G 10: 79,737,883 F995L probably benign Het
Polrmt A G 10: 79,743,176 probably null Het
Pramef25 A G 4: 143,949,703 I277T possibly damaging Het
Rims1 T C 1: 22,533,996 T375A possibly damaging Het
Ryr3 A T 2: 112,712,429 M3145K probably damaging Het
S100a11 A G 3: 93,526,032 K61R probably benign Het
Sar1a A G 10: 61,691,294 T164A probably benign Het
Sec31b C T 19: 44,543,707 A25T probably damaging Het
Smpd2 A G 10: 41,487,354 V371A probably benign Het
Spg11 A T 2: 122,075,351 L1271* probably null Het
Svep1 T C 4: 58,115,862 T944A possibly damaging Het
Taf6 A T 5: 138,179,945 C431* probably null Het
Tdrd6 A G 17: 43,627,679 V826A not run Het
Tmem132a A G 19: 10,858,673 V831A probably damaging Het
Trpv5 A G 6: 41,674,656 I196T probably damaging Het
Ttn T A 2: 76,778,554 D17706V probably damaging Het
Uimc1 T C 13: 55,075,631 Y276C probably damaging Het
Usp24 T A 4: 106,379,079 I988K probably damaging Het
Vmn2r74 T A 7: 85,957,071 R356* probably null Het
Wdr37 A T 13: 8,819,935 H429Q probably damaging Het
Wwc2 A T 8: 47,880,150 L277Q probably damaging Het
Zscan12 T A 13: 21,368,586 N193K possibly damaging Het
Other mutations in Tnfrsf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tnfrsf8 APN 4 145292591 splice site probably null
IGL02815:Tnfrsf8 APN 4 145298778 missense possibly damaging 0.68
IGL02819:Tnfrsf8 APN 4 145269133 missense probably damaging 1.00
IGL03033:Tnfrsf8 APN 4 145292649 missense possibly damaging 0.86
IGL03105:Tnfrsf8 APN 4 145298784 missense probably damaging 1.00
IGL02837:Tnfrsf8 UTSW 4 145268998 missense probably benign 0.10
R0114:Tnfrsf8 UTSW 4 145288047 missense possibly damaging 0.95
R0326:Tnfrsf8 UTSW 4 145288459 missense possibly damaging 0.64
R0594:Tnfrsf8 UTSW 4 145296861 missense probably damaging 1.00
R0639:Tnfrsf8 UTSW 4 145288027 missense probably benign 0.24
R0826:Tnfrsf8 UTSW 4 145285138 splice site probably benign
R3056:Tnfrsf8 UTSW 4 145285325 critical splice donor site probably null
R4700:Tnfrsf8 UTSW 4 145303122 missense probably damaging 0.99
R4765:Tnfrsf8 UTSW 4 145296877 missense probably benign 0.19
R5149:Tnfrsf8 UTSW 4 145303105 missense possibly damaging 0.53
R5452:Tnfrsf8 UTSW 4 145292644 missense possibly damaging 0.96
R5632:Tnfrsf8 UTSW 4 145292633 missense possibly damaging 0.68
R5673:Tnfrsf8 UTSW 4 145285335 missense probably benign 0.14
R5877:Tnfrsf8 UTSW 4 145292687 missense probably benign 0.20
R6243:Tnfrsf8 UTSW 4 145303101 missense possibly damaging 0.61
R6259:Tnfrsf8 UTSW 4 145277524 critical splice donor site probably null
R6326:Tnfrsf8 UTSW 4 145269224 missense probably damaging 1.00
R6603:Tnfrsf8 UTSW 4 145292598 missense possibly damaging 0.70
R7025:Tnfrsf8 UTSW 4 145274403 missense possibly damaging 0.87
R7156:Tnfrsf8 UTSW 4 145315084 start codon destroyed unknown
R7313:Tnfrsf8 UTSW 4 145274382 missense probably benign 0.33
R8255:Tnfrsf8 UTSW 4 145315083 start codon destroyed probably null
R8354:Tnfrsf8 UTSW 4 145287983 missense probably benign 0.41
R8406:Tnfrsf8 UTSW 4 145292695 missense probably damaging 0.98
R8454:Tnfrsf8 UTSW 4 145287983 missense probably benign 0.41
R8554:Tnfrsf8 UTSW 4 145296941 missense probably damaging 1.00
R8894:Tnfrsf8 UTSW 4 145274468 missense possibly damaging 0.94
Z1177:Tnfrsf8 UTSW 4 145292709 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CAAGTTGTGGTAGCTTCCCAG -3'
(R):5'- GTATCTGTGCGAAGTCACCC -3'

Sequencing Primer
(F):5'- TGGTAGCTTCCCAGGTGCTAAC -3'
(R):5'- GTCACCCAGCACATGAGG -3'
Posted On2019-10-17