Mutagenetix > Incidental Mutation

Incidental Mutation 'R7505:Ntn4'

581739

Institutional Source

Beutler Lab

Gene Symbol

Ntn4

Ensembl Gene

ENSMUSG00000020019

Gene Name

netrin 4

Synonyms

beta-netrin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7505 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

93640681-93747207 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 93707284 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Tryptophan at position 291 (G291W)

Ref Sequence

ENSEMBL: ENSMUSP00000020204 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020204]

AlphaFold

Q9JI33

Predicted Effect

probably damaging
Transcript: ENSMUST00000020204
AA Change: G291W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019
AA Change: G291W

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LamNT	28	260	6.48e-55	SMART
EGF_Lam	262	329	5.83e-7	SMART
EGF_Lam	332	392	3.32e-11	SMART
EGF_Lam	395	446	3.73e-14	SMART
C345C	516	625	5.58e-25	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd2	T	A	15: 91,149,057	N719Y	possibly damaging	Het
Adamts2	T	C	11: 50,796,520	I1058T	probably benign	Het
Alb	T	A	5: 90,469,509	Y356N	probably damaging	Het
Ankrd52	A	G	10: 128,390,055	N971D	probably damaging	Het
Atp6v1c2	A	G	12: 17,297,723		probably null	Het
Atp6v1h	A	T	1: 5,124,338	I247L	probably benign	Het
Cacna1s	C	T	1: 136,085,449	R593*	probably null	Het
Cacna2d3	C	T	14: 29,045,544		probably null	Het
Cdh15	G	A	8: 122,848,492	G2D	probably benign	Het
Cebpe	G	T	14: 54,710,656	N243K	probably damaging	Het
Celf2	A	T	2: 6,624,700	M136K	probably damaging	Het
Cep290	A	G	10: 100,516,265	I778V	probably benign	Het
Col22a1	A	T	15: 71,799,399	C1592*	probably null	Het
Cpne2	A	T	8: 94,548,466	N34I	possibly damaging	Het
Cps1	A	G	1: 67,180,081	N860S	probably benign	Het
Disp2	T	G	2: 118,791,088	L767R	probably damaging	Het
Evpl	A	G	11: 116,226,987		probably null	Het
F7	A	T	8: 13,028,745	N59Y	possibly damaging	Het
Fam198a	G	C	9: 121,976,417	G425R	probably benign	Het
Fam98a	A	T	17: 75,538,238	H504Q	unknown	Het
Fbxo4	G	A	15: 3,971,421	R270C	probably benign	Het
Fcgbp	T	C	7: 28,089,674	V555A	probably damaging	Het
Fgf4	T	C	7: 144,861,761	V86A	possibly damaging	Het
Fpgt	G	T	3: 155,086,776	A538D	possibly damaging	Het
Gars	A	G	6: 55,052,177	T181A	probably benign	Het
Gbx2	A	G	1: 89,928,733	S312P	probably benign	Het
Gm13101	C	T	4: 143,964,986	C389Y	probably benign	Het
Gm21319	A	T	12: 87,773,500	N96K	probably benign	Het
Gm29735	C	T	7: 142,156,590	C175Y	unknown	Het
Gm7995	A	G	14: 42,310,357	T49A		Het
Gm8879	T	A	5: 11,131,168	Y141N	possibly damaging	Het
Hnrnpk	A	G	13: 58,399,969	M27T	probably benign	Het
Idh3b	A	G	2: 130,284,227	S20P	probably benign	Het
Idh3b	G	C	2: 130,284,233	R18G	probably benign	Het
Ighg2b	T	A	12: 113,304,980	T354S		Het
Lrfn2	T	A	17: 49,096,451	M534K	probably benign	Het
Mcpt8	G	A	14: 56,083,091	A127V	probably benign	Het
Msi2	A	T	11: 88,413,917	N176K	possibly damaging	Het
Mtr	G	T	13: 12,221,476	D621E	probably benign	Het
Nlrp5	T	A	7: 23,407,500	I63N	probably benign	Het
Nol6	T	C	4: 41,120,352	D455G	probably damaging	Het
Nrde2	A	T	12: 100,132,498	S637T	probably benign	Het
Olfr1425	T	A	19: 12,074,605	E9V	possibly damaging	Het
Olfr61	C	A	7: 140,638,052	T117K	probably damaging	Het
Otof	T	A	5: 30,371,020	T1865S	probably benign	Het
Papd7	G	T	13: 69,506,928	P476T	probably damaging	Het
Plec	A	T	15: 76,181,194	S1559T	unknown	Het
Plekhm1	C	T	11: 103,380,029		probably null	Het
Plin4	T	A	17: 56,109,357	Q49L	possibly damaging	Het
Polrmt	A	G	10: 79,737,883	F995L	probably benign	Het
Polrmt	A	G	10: 79,743,176		probably null	Het
Pramef25	A	G	4: 143,949,703	I277T	possibly damaging	Het
Rims1	T	C	1: 22,533,996	T375A	possibly damaging	Het
Ryr3	A	T	2: 112,712,429	M3145K	probably damaging	Het
S100a11	A	G	3: 93,526,032	K61R	probably benign	Het
Sar1a	A	G	10: 61,691,294	T164A	probably benign	Het
Sec31b	C	T	19: 44,543,707	A25T	probably damaging	Het
Smpd2	A	G	10: 41,487,354	V371A	probably benign	Het
Spg11	A	T	2: 122,075,351	L1271*	probably null	Het
Svep1	T	C	4: 58,115,862	T944A	possibly damaging	Het
Taf6	A	T	5: 138,179,945	C431*	probably null	Het
Tdrd6	A	G	17: 43,627,679	V826A	not run	Het
Tmem132a	A	G	19: 10,858,673	V831A	probably damaging	Het
Tnfrsf8	T	G	4: 145,269,115	D458A	probably damaging	Het
Trpv5	A	G	6: 41,674,656	I196T	probably damaging	Het
Ttn	T	A	2: 76,778,554	D17706V	probably damaging	Het
Uimc1	T	C	13: 55,075,631	Y276C	probably damaging	Het
Usp24	T	A	4: 106,379,079	I988K	probably damaging	Het
Vmn2r74	T	A	7: 85,957,071	R356*	probably null	Het
Wdr37	A	T	13: 8,819,935	H429Q	probably damaging	Het
Wwc2	A	T	8: 47,880,150	L277Q	probably damaging	Het
Zscan12	T	A	13: 21,368,586	N193K	possibly damaging	Het

Other mutations in Ntn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02052:Ntn4	APN	10	93707349	missense	probably damaging	1.00
IGL02212:Ntn4	APN	10	93644849	missense	possibly damaging	0.50
IGL02698:Ntn4	APN	10	93644659	missense	probably benign	0.19
IGL02752:Ntn4	APN	10	93710559	missense	possibly damaging	0.84
PIT4468001:Ntn4	UTSW	10	93644725	missense	probably damaging	0.99
R0131:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0131:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0132:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0419:Ntn4	UTSW	10	93682429	missense	probably benign	0.04
R1304:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1306:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1307:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1308:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1619:Ntn4	UTSW	10	93644734	missense	probably damaging	1.00
R1645:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1664:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1695:Ntn4	UTSW	10	93733602	splice site	probably null
R1796:Ntn4	UTSW	10	93745771	missense	probably damaging	1.00
R1806:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1845:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1856:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1872:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1879:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1901:Ntn4	UTSW	10	93707372	missense	possibly damaging	0.93
R1902:Ntn4	UTSW	10	93707372	missense	possibly damaging	0.93
R1925:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1926:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1927:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2060:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2113:Ntn4	UTSW	10	93644839	missense	probably damaging	1.00
R2202:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2203:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2975:Ntn4	UTSW	10	93644891	missense	probably damaging	1.00
R4277:Ntn4	UTSW	10	93741210	missense	possibly damaging	0.95
R4805:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R4806:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R4807:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R5818:Ntn4	UTSW	10	93644764	missense	probably benign	0.40
R6048:Ntn4	UTSW	10	93707266	splice site	probably null
R6051:Ntn4	UTSW	10	93745795	missense	probably benign
R6346:Ntn4	UTSW	10	93644861	missense	probably damaging	1.00
R6752:Ntn4	UTSW	10	93734175	missense	probably benign
R7196:Ntn4	UTSW	10	93733714	missense	probably benign	0.01
R7240:Ntn4	UTSW	10	93745741	missense	probably damaging	0.99
R7365:Ntn4	UTSW	10	93644804	missense	probably damaging	1.00
R7374:Ntn4	UTSW	10	93682572	missense	probably benign
R7509:Ntn4	UTSW	10	93710568	missense	probably benign	0.01
R7726:Ntn4	UTSW	10	93733682	missense	possibly damaging	0.82
R7957:Ntn4	UTSW	10	93644473	splice site	probably benign
R8092:Ntn4	UTSW	10	93741056	missense	probably damaging	0.97
R8202:Ntn4	UTSW	10	93644903	missense	possibly damaging	0.88
R8508:Ntn4	UTSW	10	93741104	missense	possibly damaging	0.48
R9010:Ntn4	UTSW	10	93644644	missense
R9115:Ntn4	UTSW	10	93733813	missense	probably benign
R9415:Ntn4	UTSW	10	93644626	missense	probably benign	0.00
RF045:Ntn4	UTSW	10	93710625	missense	possibly damaging	0.95
X0024:Ntn4	UTSW	10	93644971	missense	probably damaging	1.00
Z1176:Ntn4	UTSW	10	93741153	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGCAGAATTTCTCACTGGAGCC -3'
(R):5'- CAGGCTGTTTCCAACGGTTG -3'

Sequencing Primer
(F):5'- CCTTTGAGTTAATCACAAGACAGAC -3'
(R):5'- AACGGTTGGAGTCACGCTG -3'

Posted On

2019-10-17