Incidental Mutation 'R7505:Nrde2'
ID581746
Institutional Source Beutler Lab
Gene Symbol Nrde2
Ensembl Gene ENSMUSG00000021179
Gene Namenrde-2 necessary for RNA interference, domain containing
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7505 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location100125452-100159653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100132498 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 637 (S637T)
Ref Sequence ENSEMBL: ENSMUSP00000021596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021596]
Predicted Effect probably benign
Transcript: ENSMUST00000021596
AA Change: S637T

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021596
Gene: ENSMUSG00000021179
AA Change: S637T

DomainStartEndE-ValueType
low complexity region 85 107 N/A INTRINSIC
low complexity region 146 154 N/A INTRINSIC
Pfam:NRDE-2 318 658 1.2e-107 PFAM
Blast:HAT 765 800 2e-10 BLAST
Blast:HAT 802 841 3e-16 BLAST
Blast:HAT 986 1018 3e-10 BLAST
Blast:HAT 1075 1109 1e-14 BLAST
Blast:HAT 1111 1143 8e-15 BLAST
low complexity region 1154 1171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T A 15: 91,149,057 N719Y possibly damaging Het
Adamts2 T C 11: 50,796,520 I1058T probably benign Het
Alb T A 5: 90,469,509 Y356N probably damaging Het
Ankrd52 A G 10: 128,390,055 N971D probably damaging Het
Atp6v1c2 A G 12: 17,297,723 probably null Het
Atp6v1h A T 1: 5,124,338 I247L probably benign Het
Cacna1s C T 1: 136,085,449 R593* probably null Het
Cacna2d3 C T 14: 29,045,544 probably null Het
Cdh15 G A 8: 122,848,492 G2D probably benign Het
Cebpe G T 14: 54,710,656 N243K probably damaging Het
Celf2 A T 2: 6,624,700 M136K probably damaging Het
Cep290 A G 10: 100,516,265 I778V probably benign Het
Col22a1 A T 15: 71,799,399 C1592* probably null Het
Cpne2 A T 8: 94,548,466 N34I possibly damaging Het
Cps1 A G 1: 67,180,081 N860S probably benign Het
Disp2 T G 2: 118,791,088 L767R probably damaging Het
Evpl A G 11: 116,226,987 probably null Het
F7 A T 8: 13,028,745 N59Y possibly damaging Het
Fam198a G C 9: 121,976,417 G425R probably benign Het
Fam98a A T 17: 75,538,238 H504Q unknown Het
Fbxo4 G A 15: 3,971,421 R270C probably benign Het
Fcgbp T C 7: 28,089,674 V555A probably damaging Het
Fgf4 T C 7: 144,861,761 V86A possibly damaging Het
Fpgt G T 3: 155,086,776 A538D possibly damaging Het
Gars A G 6: 55,052,177 T181A probably benign Het
Gbx2 A G 1: 89,928,733 S312P probably benign Het
Gm13101 C T 4: 143,964,986 C389Y probably benign Het
Gm21319 A T 12: 87,773,500 N96K probably benign Het
Gm29735 C T 7: 142,156,590 C175Y unknown Het
Gm7995 A G 14: 42,310,357 T49A Het
Gm8879 T A 5: 11,131,168 Y141N possibly damaging Het
Hnrnpk A G 13: 58,399,969 M27T probably benign Het
Idh3b A G 2: 130,284,227 S20P probably benign Het
Idh3b G C 2: 130,284,233 R18G probably benign Het
Ighg2b T A 12: 113,304,980 T354S Het
Lrfn2 T A 17: 49,096,451 M534K probably benign Het
Mcpt8 G A 14: 56,083,091 A127V probably benign Het
Msi2 A T 11: 88,413,917 N176K possibly damaging Het
Mtr G T 13: 12,221,476 D621E probably benign Het
Nlrp5 T A 7: 23,407,500 I63N probably benign Het
Nol6 T C 4: 41,120,352 D455G probably damaging Het
Ntn4 G T 10: 93,707,284 G291W probably damaging Het
Olfr1425 T A 19: 12,074,605 E9V possibly damaging Het
Olfr61 C A 7: 140,638,052 T117K probably damaging Het
Otof T A 5: 30,371,020 T1865S probably benign Het
Papd7 G T 13: 69,506,928 P476T probably damaging Het
Plec A T 15: 76,181,194 S1559T unknown Het
Plekhm1 C T 11: 103,380,029 probably null Het
Plin4 T A 17: 56,109,357 Q49L possibly damaging Het
Polrmt A G 10: 79,737,883 F995L probably benign Het
Polrmt A G 10: 79,743,176 probably null Het
Pramef25 A G 4: 143,949,703 I277T possibly damaging Het
Rims1 T C 1: 22,533,996 T375A possibly damaging Het
Ryr3 A T 2: 112,712,429 M3145K probably damaging Het
S100a11 A G 3: 93,526,032 K61R probably benign Het
Sar1a A G 10: 61,691,294 T164A probably benign Het
Sec31b C T 19: 44,543,707 A25T probably damaging Het
Smpd2 A G 10: 41,487,354 V371A probably benign Het
Spg11 A T 2: 122,075,351 L1271* probably null Het
Svep1 T C 4: 58,115,862 T944A possibly damaging Het
Taf6 A T 5: 138,179,945 C431* probably null Het
Tdrd6 A G 17: 43,627,679 V826A not run Het
Tmem132a A G 19: 10,858,673 V831A probably damaging Het
Tnfrsf8 T G 4: 145,269,115 D458A probably damaging Het
Trpv5 A G 6: 41,674,656 I196T probably damaging Het
Ttn T A 2: 76,778,554 D17706V probably damaging Het
Uimc1 T C 13: 55,075,631 Y276C probably damaging Het
Usp24 T A 4: 106,379,079 I988K probably damaging Het
Vmn2r74 T A 7: 85,957,071 R356* probably null Het
Wdr37 A T 13: 8,819,935 H429Q probably damaging Het
Wwc2 A T 8: 47,880,150 L277Q probably damaging Het
Zscan12 T A 13: 21,368,586 N193K possibly damaging Het
Other mutations in Nrde2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02207:Nrde2 APN 12 100130931 missense probably benign 0.01
IGL02697:Nrde2 APN 12 100131207 missense probably damaging 1.00
IGL02798:Nrde2 APN 12 100143822 nonsense probably null
IGL02810:Nrde2 APN 12 100143758 missense possibly damaging 0.81
IGL02814:Nrde2 APN 12 100144135 missense probably null 0.80
IGL02990:Nrde2 APN 12 100142096 missense probably damaging 1.00
kurtz UTSW 12 100134405 missense possibly damaging 0.92
R0090:Nrde2 UTSW 12 100129286 splice site probably benign
R0576:Nrde2 UTSW 12 100132233 missense possibly damaging 0.82
R0646:Nrde2 UTSW 12 100143846 nonsense probably null
R1130:Nrde2 UTSW 12 100125670 missense probably damaging 0.97
R1216:Nrde2 UTSW 12 100149810 splice site probably benign
R1661:Nrde2 UTSW 12 100149860 missense probably benign 0.19
R2069:Nrde2 UTSW 12 100142232 missense probably damaging 1.00
R4405:Nrde2 UTSW 12 100130584 missense probably benign 0.01
R4422:Nrde2 UTSW 12 100146027 nonsense probably null
R5169:Nrde2 UTSW 12 100129293 critical splice donor site probably null
R5200:Nrde2 UTSW 12 100130497 missense possibly damaging 0.77
R5338:Nrde2 UTSW 12 100130778 missense probably damaging 1.00
R5512:Nrde2 UTSW 12 100142250 missense probably benign 0.20
R5820:Nrde2 UTSW 12 100132287 missense probably benign 0.00
R6019:Nrde2 UTSW 12 100132242 missense probably benign 0.04
R6346:Nrde2 UTSW 12 100132306 missense probably benign 0.01
R6378:Nrde2 UTSW 12 100130757 missense probably damaging 0.99
R6479:Nrde2 UTSW 12 100143948 missense probably benign 0.00
R6523:Nrde2 UTSW 12 100134405 missense possibly damaging 0.92
R7073:Nrde2 UTSW 12 100132488 missense probably benign 0.00
R7220:Nrde2 UTSW 12 100130919 missense probably benign 0.05
R7412:Nrde2 UTSW 12 100142250 nonsense probably null
R7699:Nrde2 UTSW 12 100130835 missense probably benign 0.16
R7700:Nrde2 UTSW 12 100130835 missense probably benign 0.16
R7733:Nrde2 UTSW 12 100144140 missense possibly damaging 0.92
R7868:Nrde2 UTSW 12 100131187 missense possibly damaging 0.65
R7951:Nrde2 UTSW 12 100131187 missense possibly damaging 0.65
R8131:Nrde2 UTSW 12 100142243 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CATTGCGGACAAACTCCTCG -3'
(R):5'- GTGTTGGGAGGAAACCTAGC -3'

Sequencing Primer
(F):5'- AACTGTTCCATGGAGCCGAC -3'
(R):5'- CTAAAACCTAGCTACTGTCTATTTGC -3'
Posted On2019-10-17