Incidental Mutation 'R7505:Zscan12'
ID581750
Institutional Source Beutler Lab
Gene Symbol Zscan12
Ensembl Gene ENSMUSG00000036721
Gene Namezinc finger and SCAN domain containing 12
SynonymsZfp96
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7505 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location21362820-21372289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21368586 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 193 (N193K)
Ref Sequence ENSEMBL: ENSMUSP00000058904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053293] [ENSMUST00000099720] [ENSMUST00000225545]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053293
AA Change: N193K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058904
Gene: ENSMUSG00000036721
AA Change: N193K

DomainStartEndE-ValueType
SCAN 42 154 2.52e-74 SMART
ZnF_C2H2 269 291 5.5e-3 SMART
ZnF_C2H2 297 319 1.72e-4 SMART
ZnF_C2H2 325 347 1.22e-4 SMART
ZnF_C2H2 353 375 5.5e-3 SMART
ZnF_C2H2 381 403 1.95e-3 SMART
ZnF_C2H2 409 431 1.45e-2 SMART
ZnF_C2H2 455 477 2.43e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000099720
AA Change: N193K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097308
Gene: ENSMUSG00000036721
AA Change: N193K

DomainStartEndE-ValueType
SCAN 42 154 2.52e-74 SMART
ZnF_C2H2 269 291 5.5e-3 SMART
ZnF_C2H2 297 319 1.72e-4 SMART
ZnF_C2H2 325 347 1.22e-4 SMART
ZnF_C2H2 353 375 5.5e-3 SMART
ZnF_C2H2 381 403 1.95e-3 SMART
ZnF_C2H2 409 431 1.45e-2 SMART
ZnF_C2H2 455 477 2.43e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000225545
AA Change: N193K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T A 15: 91,149,057 N719Y possibly damaging Het
Adamts2 T C 11: 50,796,520 I1058T probably benign Het
Alb T A 5: 90,469,509 Y356N probably damaging Het
Ankrd52 A G 10: 128,390,055 N971D probably damaging Het
Atp6v1c2 A G 12: 17,297,723 probably null Het
Atp6v1h A T 1: 5,124,338 I247L probably benign Het
Cacna1s C T 1: 136,085,449 R593* probably null Het
Cacna2d3 C T 14: 29,045,544 probably null Het
Cdh15 G A 8: 122,848,492 G2D probably benign Het
Cebpe G T 14: 54,710,656 N243K probably damaging Het
Celf2 A T 2: 6,624,700 M136K probably damaging Het
Cep290 A G 10: 100,516,265 I778V probably benign Het
Col22a1 A T 15: 71,799,399 C1592* probably null Het
Cpne2 A T 8: 94,548,466 N34I possibly damaging Het
Cps1 A G 1: 67,180,081 N860S probably benign Het
Disp2 T G 2: 118,791,088 L767R probably damaging Het
Evpl A G 11: 116,226,987 probably null Het
F7 A T 8: 13,028,745 N59Y possibly damaging Het
Fam198a G C 9: 121,976,417 G425R probably benign Het
Fam98a A T 17: 75,538,238 H504Q unknown Het
Fbxo4 G A 15: 3,971,421 R270C probably benign Het
Fcgbp T C 7: 28,089,674 V555A probably damaging Het
Fgf4 T C 7: 144,861,761 V86A possibly damaging Het
Fpgt G T 3: 155,086,776 A538D possibly damaging Het
Gars A G 6: 55,052,177 T181A probably benign Het
Gbx2 A G 1: 89,928,733 S312P probably benign Het
Gm13101 C T 4: 143,964,986 C389Y probably benign Het
Gm21319 A T 12: 87,773,500 N96K probably benign Het
Gm29735 C T 7: 142,156,590 C175Y unknown Het
Gm7995 A G 14: 42,310,357 T49A Het
Gm8879 T A 5: 11,131,168 Y141N possibly damaging Het
Hnrnpk A G 13: 58,399,969 M27T probably benign Het
Idh3b A G 2: 130,284,227 S20P probably benign Het
Idh3b G C 2: 130,284,233 R18G probably benign Het
Ighg2b T A 12: 113,304,980 T354S Het
Lrfn2 T A 17: 49,096,451 M534K probably benign Het
Mcpt8 G A 14: 56,083,091 A127V probably benign Het
Msi2 A T 11: 88,413,917 N176K possibly damaging Het
Mtr G T 13: 12,221,476 D621E probably benign Het
Nlrp5 T A 7: 23,407,500 I63N probably benign Het
Nol6 T C 4: 41,120,352 D455G probably damaging Het
Nrde2 A T 12: 100,132,498 S637T probably benign Het
Ntn4 G T 10: 93,707,284 G291W probably damaging Het
Olfr1425 T A 19: 12,074,605 E9V possibly damaging Het
Olfr61 C A 7: 140,638,052 T117K probably damaging Het
Otof T A 5: 30,371,020 T1865S probably benign Het
Papd7 G T 13: 69,506,928 P476T probably damaging Het
Plec A T 15: 76,181,194 S1559T unknown Het
Plekhm1 C T 11: 103,380,029 probably null Het
Plin4 T A 17: 56,109,357 Q49L possibly damaging Het
Polrmt A G 10: 79,737,883 F995L probably benign Het
Polrmt A G 10: 79,743,176 probably null Het
Pramef25 A G 4: 143,949,703 I277T possibly damaging Het
Rims1 T C 1: 22,533,996 T375A possibly damaging Het
Ryr3 A T 2: 112,712,429 M3145K probably damaging Het
S100a11 A G 3: 93,526,032 K61R probably benign Het
Sar1a A G 10: 61,691,294 T164A probably benign Het
Sec31b C T 19: 44,543,707 A25T probably damaging Het
Smpd2 A G 10: 41,487,354 V371A probably benign Het
Spg11 A T 2: 122,075,351 L1271* probably null Het
Svep1 T C 4: 58,115,862 T944A possibly damaging Het
Taf6 A T 5: 138,179,945 C431* probably null Het
Tdrd6 A G 17: 43,627,679 V826A not run Het
Tmem132a A G 19: 10,858,673 V831A probably damaging Het
Tnfrsf8 T G 4: 145,269,115 D458A probably damaging Het
Trpv5 A G 6: 41,674,656 I196T probably damaging Het
Ttn T A 2: 76,778,554 D17706V probably damaging Het
Uimc1 T C 13: 55,075,631 Y276C probably damaging Het
Usp24 T A 4: 106,379,079 I988K probably damaging Het
Vmn2r74 T A 7: 85,957,071 R356* probably null Het
Wdr37 A T 13: 8,819,935 H429Q probably damaging Het
Wwc2 A T 8: 47,880,150 L277Q probably damaging Het
Other mutations in Zscan12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02864:Zscan12 APN 13 21368560 missense probably benign 0.02
PIT4480001:Zscan12 UTSW 13 21368574 missense possibly damaging 0.72
R0122:Zscan12 UTSW 13 21368969 missense probably damaging 1.00
R1605:Zscan12 UTSW 13 21366643 missense probably benign 0.00
R1639:Zscan12 UTSW 13 21368986 missense probably damaging 0.99
R2182:Zscan12 UTSW 13 21368791 missense probably benign 0.33
R2931:Zscan12 UTSW 13 21364017 missense possibly damaging 0.92
R3930:Zscan12 UTSW 13 21368630 missense probably benign 0.18
R4368:Zscan12 UTSW 13 21369383 missense probably benign 0.00
R4461:Zscan12 UTSW 13 21366619 missense possibly damaging 0.83
R4545:Zscan12 UTSW 13 21366705 missense possibly damaging 0.83
R5353:Zscan12 UTSW 13 21364008 missense possibly damaging 0.51
R6580:Zscan12 UTSW 13 21369158 missense probably damaging 0.99
R6734:Zscan12 UTSW 13 21368796 nonsense probably null
R7462:Zscan12 UTSW 13 21369287 missense possibly damaging 0.94
R7822:Zscan12 UTSW 13 21369204 missense probably damaging 0.99
R8028:Zscan12 UTSW 13 21368852 missense probably benign 0.01
R8056:Zscan12 UTSW 13 21369322 missense probably benign 0.29
R8161:Zscan12 UTSW 13 21363727 missense probably benign 0.01
R8784:Zscan12 UTSW 13 21363821 missense possibly damaging 0.82
R8794:Zscan12 UTSW 13 21363677 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AAATCACATAGTTCCCCTCTGC -3'
(R):5'- GAGTTCGCAGGAGAATTTACACC -3'

Sequencing Primer
(F):5'- ATCTCTTTATTCATTTTGGGGGTGC -3'
(R):5'- ACCATTTTCATTACGCAGAGGCTG -3'
Posted On2019-10-17