Incidental Mutation 'R7505:Col22a1'
ID 581758
Institutional Source Beutler Lab
Gene Symbol Col22a1
Ensembl Gene ENSMUSG00000079022
Gene Name collagen, type XXII, alpha 1
Synonyms C80743, 2310067L16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7505 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 71795795-72034227 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 71799399 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 1592 (C1592*)
Ref Sequence ENSEMBL: ENSMUSP00000125069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159993] [ENSMUST00000229585]
AlphaFold E9Q7P1
Predicted Effect probably null
Transcript: ENSMUST00000159993
AA Change: C1592*
SMART Domains Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022
AA Change: C1592*

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
VWA 45 227 1.35e-51 SMART
TSPN 248 436 1.26e-33 SMART
low complexity region 454 470 N/A INTRINSIC
internal_repeat_3 494 555 1.96e-13 PROSPERO
internal_repeat_1 496 643 1.49e-19 PROSPERO
low complexity region 644 657 N/A INTRINSIC
low complexity region 673 707 N/A INTRINSIC
Pfam:Collagen 751 823 1.5e-9 PFAM
Pfam:Collagen 810 863 2.3e-10 PFAM
Pfam:Collagen 869 931 4.8e-11 PFAM
Pfam:Collagen 926 990 1.1e-10 PFAM
Pfam:Collagen 1031 1087 1.7e-10 PFAM
Pfam:Collagen 1104 1162 1.8e-11 PFAM
low complexity region 1173 1227 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
internal_repeat_2 1257 1348 3.25e-18 PROSPERO
internal_repeat_4 1268 1347 9.67e-7 PROSPERO
Pfam:Collagen 1389 1448 4e-10 PFAM
Pfam:Collagen 1481 1540 2.6e-9 PFAM
low complexity region 1546 1558 N/A INTRINSIC
low complexity region 1580 1590 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000229585
AA Change: C1037*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T A 15: 91,149,057 N719Y possibly damaging Het
Adamts2 T C 11: 50,796,520 I1058T probably benign Het
Alb T A 5: 90,469,509 Y356N probably damaging Het
Ankrd52 A G 10: 128,390,055 N971D probably damaging Het
Atp6v1c2 A G 12: 17,297,723 probably null Het
Atp6v1h A T 1: 5,124,338 I247L probably benign Het
Cacna1s C T 1: 136,085,449 R593* probably null Het
Cacna2d3 C T 14: 29,045,544 probably null Het
Cdh15 G A 8: 122,848,492 G2D probably benign Het
Cebpe G T 14: 54,710,656 N243K probably damaging Het
Celf2 A T 2: 6,624,700 M136K probably damaging Het
Cep290 A G 10: 100,516,265 I778V probably benign Het
Cpne2 A T 8: 94,548,466 N34I possibly damaging Het
Cps1 A G 1: 67,180,081 N860S probably benign Het
Disp2 T G 2: 118,791,088 L767R probably damaging Het
Evpl A G 11: 116,226,987 probably null Het
F7 A T 8: 13,028,745 N59Y possibly damaging Het
Fam198a G C 9: 121,976,417 G425R probably benign Het
Fam98a A T 17: 75,538,238 H504Q unknown Het
Fbxo4 G A 15: 3,971,421 R270C probably benign Het
Fcgbp T C 7: 28,089,674 V555A probably damaging Het
Fgf4 T C 7: 144,861,761 V86A possibly damaging Het
Fpgt G T 3: 155,086,776 A538D possibly damaging Het
Gars A G 6: 55,052,177 T181A probably benign Het
Gbx2 A G 1: 89,928,733 S312P probably benign Het
Gm13101 C T 4: 143,964,986 C389Y probably benign Het
Gm21319 A T 12: 87,773,500 N96K probably benign Het
Gm29735 C T 7: 142,156,590 C175Y unknown Het
Gm7995 A G 14: 42,310,357 T49A Het
Gm8879 T A 5: 11,131,168 Y141N possibly damaging Het
Hnrnpk A G 13: 58,399,969 M27T probably benign Het
Idh3b A G 2: 130,284,227 S20P probably benign Het
Idh3b G C 2: 130,284,233 R18G probably benign Het
Ighg2b T A 12: 113,304,980 T354S Het
Lrfn2 T A 17: 49,096,451 M534K probably benign Het
Mcpt8 G A 14: 56,083,091 A127V probably benign Het
Msi2 A T 11: 88,413,917 N176K possibly damaging Het
Mtr G T 13: 12,221,476 D621E probably benign Het
Nlrp5 T A 7: 23,407,500 I63N probably benign Het
Nol6 T C 4: 41,120,352 D455G probably damaging Het
Nrde2 A T 12: 100,132,498 S637T probably benign Het
Ntn4 G T 10: 93,707,284 G291W probably damaging Het
Olfr1425 T A 19: 12,074,605 E9V possibly damaging Het
Olfr61 C A 7: 140,638,052 T117K probably damaging Het
Otof T A 5: 30,371,020 T1865S probably benign Het
Papd7 G T 13: 69,506,928 P476T probably damaging Het
Plec A T 15: 76,181,194 S1559T unknown Het
Plekhm1 C T 11: 103,380,029 probably null Het
Plin4 T A 17: 56,109,357 Q49L possibly damaging Het
Polrmt A G 10: 79,737,883 F995L probably benign Het
Polrmt A G 10: 79,743,176 probably null Het
Pramef25 A G 4: 143,949,703 I277T possibly damaging Het
Rims1 T C 1: 22,533,996 T375A possibly damaging Het
Ryr3 A T 2: 112,712,429 M3145K probably damaging Het
S100a11 A G 3: 93,526,032 K61R probably benign Het
Sar1a A G 10: 61,691,294 T164A probably benign Het
Sec31b C T 19: 44,543,707 A25T probably damaging Het
Smpd2 A G 10: 41,487,354 V371A probably benign Het
Spg11 A T 2: 122,075,351 L1271* probably null Het
Svep1 T C 4: 58,115,862 T944A possibly damaging Het
Taf6 A T 5: 138,179,945 C431* probably null Het
Tdrd6 A G 17: 43,627,679 V826A not run Het
Tmem132a A G 19: 10,858,673 V831A probably damaging Het
Tnfrsf8 T G 4: 145,269,115 D458A probably damaging Het
Trpv5 A G 6: 41,674,656 I196T probably damaging Het
Ttn T A 2: 76,778,554 D17706V probably damaging Het
Uimc1 T C 13: 55,075,631 Y276C probably damaging Het
Usp24 T A 4: 106,379,079 I988K probably damaging Het
Vmn2r74 T A 7: 85,957,071 R356* probably null Het
Wdr37 A T 13: 8,819,935 H429Q probably damaging Het
Wwc2 A T 8: 47,880,150 L277Q probably damaging Het
Zscan12 T A 13: 21,368,586 N193K possibly damaging Het
Other mutations in Col22a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Col22a1 APN 15 71860958 critical splice donor site probably null
IGL00434:Col22a1 APN 15 72006675 missense possibly damaging 0.71
IGL00721:Col22a1 APN 15 71846177 missense unknown
IGL00902:Col22a1 APN 15 71964659 missense probably damaging 1.00
IGL01311:Col22a1 APN 15 71973637 splice site probably benign
IGL01329:Col22a1 APN 15 71907040 missense probably benign 0.02
IGL01527:Col22a1 APN 15 71907031 missense probably damaging 0.98
IGL01870:Col22a1 APN 15 71952528 missense probably benign 0.07
IGL02002:Col22a1 APN 15 71811097 splice site probably benign
IGL02248:Col22a1 APN 15 71799448 missense unknown
IGL02322:Col22a1 APN 15 71822653 missense unknown
IGL02472:Col22a1 APN 15 71827753 splice site probably benign
IGL02685:Col22a1 APN 15 71801915 missense unknown
IGL02888:Col22a1 APN 15 71846219 missense unknown
IGL02971:Col22a1 APN 15 72006738 missense probably damaging 1.00
IGL03175:Col22a1 APN 15 71969103 missense possibly damaging 0.81
IGL03240:Col22a1 APN 15 71807928 missense unknown
R0083:Col22a1 UTSW 15 71890497 missense possibly damaging 0.70
R0383:Col22a1 UTSW 15 71869004 missense unknown
R0449:Col22a1 UTSW 15 71962671 critical splice donor site probably null
R0508:Col22a1 UTSW 15 71933413 missense unknown
R0944:Col22a1 UTSW 15 71881662 missense probably benign 0.03
R1289:Col22a1 UTSW 15 71837377 missense unknown
R1436:Col22a1 UTSW 15 71922957 splice site probably benign
R1439:Col22a1 UTSW 15 71952377 splice site probably benign
R1460:Col22a1 UTSW 15 71821931 missense unknown
R1680:Col22a1 UTSW 15 71799361 missense unknown
R1715:Col22a1 UTSW 15 72006981 missense possibly damaging 0.79
R1742:Col22a1 UTSW 15 71801913 missense unknown
R1745:Col22a1 UTSW 15 72006787 missense probably damaging 1.00
R1763:Col22a1 UTSW 15 72007176 missense probably damaging 0.96
R1932:Col22a1 UTSW 15 71870140 missense unknown
R2125:Col22a1 UTSW 15 71848577 missense unknown
R2126:Col22a1 UTSW 15 71857253 nonsense probably null
R2137:Col22a1 UTSW 15 72006948 missense possibly damaging 0.46
R2860:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R2861:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R2862:Col22a1 UTSW 15 71815943 critical splice donor site probably null
R3704:Col22a1 UTSW 15 71970307 missense probably damaging 1.00
R3778:Col22a1 UTSW 15 71973692 missense probably damaging 1.00
R3940:Col22a1 UTSW 15 71981933 nonsense probably null
R3950:Col22a1 UTSW 15 71977358 missense possibly damaging 0.90
R4240:Col22a1 UTSW 15 72007131 missense probably damaging 1.00
R4531:Col22a1 UTSW 15 72007149 missense probably damaging 1.00
R4597:Col22a1 UTSW 15 71964662 missense possibly damaging 0.83
R4604:Col22a1 UTSW 15 71952339 missense probably benign 0.36
R4654:Col22a1 UTSW 15 71973695 missense possibly damaging 0.95
R4782:Col22a1 UTSW 15 71801925 missense unknown
R4847:Col22a1 UTSW 15 71799499 missense unknown
R4980:Col22a1 UTSW 15 71801943 missense unknown
R4981:Col22a1 UTSW 15 71861066 missense unknown
R4996:Col22a1 UTSW 15 72007161 missense probably damaging 0.99
R5007:Col22a1 UTSW 15 71944422 missense probably damaging 1.00
R5135:Col22a1 UTSW 15 71799337 missense unknown
R5197:Col22a1 UTSW 15 72009406 missense probably damaging 0.96
R5292:Col22a1 UTSW 15 71970336 missense probably damaging 1.00
R5449:Col22a1 UTSW 15 71821949 missense unknown
R5480:Col22a1 UTSW 15 71964611 missense probably damaging 0.98
R5627:Col22a1 UTSW 15 71981918 missense probably damaging 0.98
R5828:Col22a1 UTSW 15 72009491 missense probably benign 0.01
R5927:Col22a1 UTSW 15 72006966 missense probably damaging 1.00
R6006:Col22a1 UTSW 15 71973836 missense probably damaging 1.00
R6245:Col22a1 UTSW 15 71973816 missense probably damaging 0.99
R6288:Col22a1 UTSW 15 71894869 critical splice acceptor site probably null
R6482:Col22a1 UTSW 15 71890489 missense possibly damaging 0.93
R6497:Col22a1 UTSW 15 71890576 missense possibly damaging 0.85
R6579:Col22a1 UTSW 15 71881653 missense probably benign 0.18
R6643:Col22a1 UTSW 15 71822037 splice site probably null
R6663:Col22a1 UTSW 15 71820059 missense unknown
R7179:Col22a1 UTSW 15 71933413 missense unknown
R7215:Col22a1 UTSW 15 71970332 nonsense probably null
R7216:Col22a1 UTSW 15 71973845 missense probably damaging 1.00
R7585:Col22a1 UTSW 15 71892205 missense probably damaging 0.99
R7699:Col22a1 UTSW 15 71973851 missense probably damaging 1.00
R7788:Col22a1 UTSW 15 71952317 critical splice donor site probably null
R7921:Col22a1 UTSW 15 71981962 splice site probably null
R8205:Col22a1 UTSW 15 71861069 missense unknown
R8769:Col22a1 UTSW 15 72006722 missense probably benign 0.21
R8780:Col22a1 UTSW 15 72006947 missense probably damaging 0.99
R8827:Col22a1 UTSW 15 71902816 critical splice donor site probably null
R8843:Col22a1 UTSW 15 72006654 missense probably damaging 1.00
R8982:Col22a1 UTSW 15 71973638 critical splice donor site probably null
R9031:Col22a1 UTSW 15 71881674 nonsense probably null
R9036:Col22a1 UTSW 15 71890582 missense probably damaging 1.00
R9084:Col22a1 UTSW 15 71820080 missense unknown
R9281:Col22a1 UTSW 15 71861071 missense unknown
R9386:Col22a1 UTSW 15 71981945 missense probably damaging 1.00
R9406:Col22a1 UTSW 15 71973692 missense probably damaging 1.00
R9577:Col22a1 UTSW 15 71965746 missense probably damaging 0.99
X0066:Col22a1 UTSW 15 71801879 missense unknown
X0066:Col22a1 UTSW 15 71846200 missense unknown
Y5406:Col22a1 UTSW 15 71799515 missense unknown
Z1177:Col22a1 UTSW 15 71915120 missense unknown
Predicted Primers PCR Primer
(F):5'- AACTGTGAGGTCTCTGAGGAC -3'
(R):5'- ACAGGGCTGTTTCTCTCCTG -3'

Sequencing Primer
(F):5'- TCTCTGAGGACGGGAAAAGAC -3'
(R):5'- GCTGTTTCTCTCCTGGATATAAAATG -3'
Posted On 2019-10-17