Incidental Mutation 'R0634:Cntn1'
ID58176
Institutional Source Beutler Lab
Gene Symbol Cntn1
Ensembl Gene ENSMUSG00000055022
Gene Namecontactin 1
SynonymsCNTN, F3cam
MMRRC Submission 038823-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0634 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location92051165-92341967 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 92314563 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 869 (R869*)
Ref Sequence ENSEMBL: ENSMUSP00000133063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000109] [ENSMUST00000068378] [ENSMUST00000169825]
Predicted Effect probably null
Transcript: ENSMUST00000000109
AA Change: R869*
SMART Domains Protein: ENSMUSP00000000109
Gene: ENSMUSG00000055022
AA Change: R869*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000068378
AA Change: R869*
SMART Domains Protein: ENSMUSP00000067842
Gene: ENSMUSG00000055022
AA Change: R869*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169825
AA Change: R869*
SMART Domains Protein: ENSMUSP00000133063
Gene: ENSMUSG00000055022
AA Change: R869*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mutations of this gene result in growth retardation, progressive ataxia and death prior to weaning. A targeted null mutation, but not a spontaneous mutation, causes a small cerebellum with abnormalities of the molecular layer and abnormal Purkinje cellaxon morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,314,491 I2958V possibly damaging Het
Adam21 C A 12: 81,560,352 W212L probably benign Het
Adcy2 A C 13: 68,727,945 H479Q possibly damaging Het
Adcy4 T C 14: 55,781,597 R168G probably benign Het
Atp13a2 T C 4: 141,006,929 probably benign Het
C1ra G A 6: 124,517,505 E304K possibly damaging Het
C87977 A G 4: 144,209,340 probably null Het
Cc2d2a A C 5: 43,681,381 probably benign Het
Cenpe T C 3: 135,246,827 L1426P probably damaging Het
Creb3l2 A T 6: 37,334,348 probably benign Het
Crybg2 G A 4: 134,075,304 probably benign Het
Csmd1 A T 8: 16,226,391 F800I probably damaging Het
Dock6 G A 9: 21,841,527 T330I probably damaging Het
Ets2 G A 16: 95,716,156 E311K possibly damaging Het
Fbxo22 A T 9: 55,214,960 Q141L probably benign Het
Fer C T 17: 64,035,508 T223M probably benign Het
Gm13757 A T 2: 88,446,617 M107K probably benign Het
Gm9774 C T 3: 92,428,809 W125* probably null Het
Gtf3c1 A T 7: 125,657,477 probably benign Het
Gtf3c2 G A 5: 31,159,806 R684* probably null Het
Hs6st3 T A 14: 119,869,062 L294* probably null Het
Ighg2c T G 12: 113,287,964 E181A unknown Het
Igkv6-15 A T 6: 70,406,779 probably benign Het
Lrmp A T 6: 145,174,628 H523L probably damaging Het
Map2k6 C T 11: 110,494,343 R178* probably null Het
Meikin T A 11: 54,390,483 D126E probably benign Het
Mgst1 A T 6: 138,156,331 T37S probably damaging Het
Mrc2 G A 11: 105,347,692 V1222M probably benign Het
Myom2 C A 8: 15,119,216 probably benign Het
Negr1 A G 3: 157,016,266 K159R possibly damaging Het
Nptx1 T C 11: 119,543,301 T320A possibly damaging Het
Olfr490 T C 7: 108,286,296 I277V probably benign Het
Olfr530 A T 7: 140,373,397 V71E possibly damaging Het
Pes1 C T 11: 3,977,794 probably benign Het
Pes1 T G 11: 3,977,795 probably benign Het
Pkhd1 A T 1: 20,117,474 Y3537N probably damaging Het
Poteg G A 8: 27,473,587 G289R probably benign Het
Rassf5 T C 1: 131,244,956 R59G probably damaging Het
Reln A T 5: 22,018,869 W961R probably damaging Het
Rhot2 G A 17: 25,842,028 H168Y possibly damaging Het
Ripk3 G T 14: 55,788,391 probably benign Het
Samm50 A G 15: 84,214,171 silent Het
Sap30bp T C 11: 115,957,403 I117T probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Sipa1l2 A T 8: 125,422,624 L1632* probably null Het
Sirt7 T C 11: 120,622,129 probably benign Het
Smg8 T C 11: 87,086,108 T216A possibly damaging Het
Sox9 A G 11: 112,784,942 Y319C probably damaging Het
Sspn G A 6: 145,961,151 A27T possibly damaging Het
Suco A G 1: 161,838,804 V509A possibly damaging Het
Svep1 C T 4: 58,070,661 C2375Y possibly damaging Het
Trbv21 T A 6: 41,203,050 probably benign Het
Uimc1 C T 13: 55,060,266 E455K possibly damaging Het
Upk3b A G 5: 136,040,076 T100A possibly damaging Het
Usp47 A G 7: 112,108,655 N1303D probably damaging Het
Vav1 A T 17: 57,303,862 D476V probably benign Het
Vmn1r68 A G 7: 10,527,235 V312A probably benign Het
Wdr62 A G 7: 30,270,174 V287A probably damaging Het
Zcchc4 C T 5: 52,783,208 P40S probably benign Het
Zfp326 T A 5: 105,886,203 Y26* probably null Het
Zfp592 A G 7: 81,038,071 H915R probably damaging Het
Other mutations in Cntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Cntn1 APN 15 92250877 missense possibly damaging 0.92
IGL01109:Cntn1 APN 15 92339577 nonsense probably null
IGL01399:Cntn1 APN 15 92305144 missense probably damaging 1.00
IGL01714:Cntn1 APN 15 92253989 nonsense probably null
IGL02052:Cntn1 APN 15 92291703 missense possibly damaging 0.95
IGL02342:Cntn1 APN 15 92246017 missense probably benign 0.01
IGL02507:Cntn1 APN 15 92250979 missense possibly damaging 0.92
IGL02511:Cntn1 APN 15 92216385 start gained probably benign
IGL02702:Cntn1 APN 15 92291601 splice site probably benign
IGL02927:Cntn1 APN 15 92291680 missense probably benign 0.12
IGL02948:Cntn1 APN 15 92246010 missense probably benign 0.01
R0035:Cntn1 UTSW 15 92232088 splice site probably benign
R0084:Cntn1 UTSW 15 92317917 missense probably benign 0.01
R0346:Cntn1 UTSW 15 92232087 splice site probably benign
R1348:Cntn1 UTSW 15 92314663 missense probably damaging 1.00
R1613:Cntn1 UTSW 15 92245990 missense possibly damaging 0.60
R1793:Cntn1 UTSW 15 92291671 missense possibly damaging 0.92
R1815:Cntn1 UTSW 15 92250948 missense probably benign 0.00
R1851:Cntn1 UTSW 15 92305140 missense probably damaging 1.00
R1852:Cntn1 UTSW 15 92305140 missense probably damaging 1.00
R2068:Cntn1 UTSW 15 92318062 missense possibly damaging 0.82
R2269:Cntn1 UTSW 15 92294982 splice site probably benign
R4394:Cntn1 UTSW 15 92291764 missense probably damaging 1.00
R4667:Cntn1 UTSW 15 92295079 missense probably damaging 1.00
R4771:Cntn1 UTSW 15 92305091 missense possibly damaging 0.82
R4944:Cntn1 UTSW 15 92228668 missense probably damaging 1.00
R5044:Cntn1 UTSW 15 92242995 missense probably damaging 1.00
R5218:Cntn1 UTSW 15 92339549 missense unknown
R5314:Cntn1 UTSW 15 92295011 missense probably benign 0.01
R5445:Cntn1 UTSW 15 92295077 missense probably damaging 1.00
R5518:Cntn1 UTSW 15 92314653 missense probably benign 0.00
R6849:Cntn1 UTSW 15 92305246 missense probably damaging 0.99
R6885:Cntn1 UTSW 15 92243099 critical splice donor site probably null
R7035:Cntn1 UTSW 15 92314511 missense probably benign 0.04
R7070:Cntn1 UTSW 15 92254036 missense probably damaging 1.00
R7287:Cntn1 UTSW 15 92245952 splice site probably null
R7311:Cntn1 UTSW 15 92232275 critical splice donor site probably null
R7401:Cntn1 UTSW 15 92317989 missense probably benign
R7484:Cntn1 UTSW 15 92254041 missense probably benign 0.00
R7492:Cntn1 UTSW 15 92314542 missense probably benign
R7617:Cntn1 UTSW 15 92246089 missense probably damaging 1.00
R7644:Cntn1 UTSW 15 92310009 missense probably benign 0.14
R7878:Cntn1 UTSW 15 92295053 missense probably damaging 1.00
R7961:Cntn1 UTSW 15 92295053 missense probably damaging 1.00
Z1177:Cntn1 UTSW 15 92309970 missense not run
Predicted Primers PCR Primer
(F):5'- TGGACTGAAATCCGTGGCAATGAAC -3'
(R):5'- GCTGGGAATGATGAAAACCCCTCC -3'

Sequencing Primer
(F):5'- TCGCCTTGGATGTTTGCAGA -3'
(R):5'- CCCTCCGATTCTATTAAAGATGTGG -3'
Posted On2013-07-11