Incidental Mutation 'R7505:Fam98a'
ID581764
Institutional Source Beutler Lab
Gene Symbol Fam98a
Ensembl Gene ENSMUSG00000002017
Gene Namefamily with sequence similarity 98, member A
Synonyms2810405J04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.644) question?
Stock #R7505 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location75537086-75551946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75538238 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 504 (H504Q)
Ref Sequence ENSEMBL: ENSMUSP00000108126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112507]
Predicted Effect unknown
Transcript: ENSMUST00000112507
AA Change: H504Q
SMART Domains Protein: ENSMUSP00000108126
Gene: ENSMUSG00000002017
AA Change: H504Q

DomainStartEndE-ValueType
Pfam:DUF2465 11 328 1.1e-137 PFAM
low complexity region 334 396 N/A INTRINSIC
low complexity region 401 441 N/A INTRINSIC
low complexity region 448 481 N/A INTRINSIC
low complexity region 485 501 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T A 15: 91,149,057 N719Y possibly damaging Het
Adamts2 T C 11: 50,796,520 I1058T probably benign Het
Alb T A 5: 90,469,509 Y356N probably damaging Het
Ankrd52 A G 10: 128,390,055 N971D probably damaging Het
Atp6v1c2 A G 12: 17,297,723 probably null Het
Atp6v1h A T 1: 5,124,338 I247L probably benign Het
Cacna1s C T 1: 136,085,449 R593* probably null Het
Cacna2d3 C T 14: 29,045,544 probably null Het
Cdh15 G A 8: 122,848,492 G2D probably benign Het
Cebpe G T 14: 54,710,656 N243K probably damaging Het
Celf2 A T 2: 6,624,700 M136K probably damaging Het
Cep290 A G 10: 100,516,265 I778V probably benign Het
Col22a1 A T 15: 71,799,399 C1592* probably null Het
Cpne2 A T 8: 94,548,466 N34I possibly damaging Het
Cps1 A G 1: 67,180,081 N860S probably benign Het
Disp2 T G 2: 118,791,088 L767R probably damaging Het
Evpl A G 11: 116,226,987 probably null Het
F7 A T 8: 13,028,745 N59Y possibly damaging Het
Fam198a G C 9: 121,976,417 G425R probably benign Het
Fbxo4 G A 15: 3,971,421 R270C probably benign Het
Fcgbp T C 7: 28,089,674 V555A probably damaging Het
Fgf4 T C 7: 144,861,761 V86A possibly damaging Het
Fpgt G T 3: 155,086,776 A538D possibly damaging Het
Gars A G 6: 55,052,177 T181A probably benign Het
Gbx2 A G 1: 89,928,733 S312P probably benign Het
Gm13101 C T 4: 143,964,986 C389Y probably benign Het
Gm21319 A T 12: 87,773,500 N96K probably benign Het
Gm29735 C T 7: 142,156,590 C175Y unknown Het
Gm7995 A G 14: 42,310,357 T49A Het
Gm8879 T A 5: 11,131,168 Y141N possibly damaging Het
Hnrnpk A G 13: 58,399,969 M27T probably benign Het
Idh3b A G 2: 130,284,227 S20P probably benign Het
Idh3b G C 2: 130,284,233 R18G probably benign Het
Ighg2b T A 12: 113,304,980 T354S Het
Lrfn2 T A 17: 49,096,451 M534K probably benign Het
Mcpt8 G A 14: 56,083,091 A127V probably benign Het
Msi2 A T 11: 88,413,917 N176K possibly damaging Het
Mtr G T 13: 12,221,476 D621E probably benign Het
Nlrp5 T A 7: 23,407,500 I63N probably benign Het
Nol6 T C 4: 41,120,352 D455G probably damaging Het
Nrde2 A T 12: 100,132,498 S637T probably benign Het
Ntn4 G T 10: 93,707,284 G291W probably damaging Het
Olfr1425 T A 19: 12,074,605 E9V possibly damaging Het
Olfr61 C A 7: 140,638,052 T117K probably damaging Het
Otof T A 5: 30,371,020 T1865S probably benign Het
Papd7 G T 13: 69,506,928 P476T probably damaging Het
Plec A T 15: 76,181,194 S1559T unknown Het
Plekhm1 C T 11: 103,380,029 probably null Het
Plin4 T A 17: 56,109,357 Q49L possibly damaging Het
Polrmt A G 10: 79,737,883 F995L probably benign Het
Polrmt A G 10: 79,743,176 probably null Het
Pramef25 A G 4: 143,949,703 I277T possibly damaging Het
Rims1 T C 1: 22,533,996 T375A possibly damaging Het
Ryr3 A T 2: 112,712,429 M3145K probably damaging Het
S100a11 A G 3: 93,526,032 K61R probably benign Het
Sar1a A G 10: 61,691,294 T164A probably benign Het
Sec31b C T 19: 44,543,707 A25T probably damaging Het
Smpd2 A G 10: 41,487,354 V371A probably benign Het
Spg11 A T 2: 122,075,351 L1271* probably null Het
Svep1 T C 4: 58,115,862 T944A possibly damaging Het
Taf6 A T 5: 138,179,945 C431* probably null Het
Tdrd6 A G 17: 43,627,679 V826A not run Het
Tmem132a A G 19: 10,858,673 V831A probably damaging Het
Tnfrsf8 T G 4: 145,269,115 D458A probably damaging Het
Trpv5 A G 6: 41,674,656 I196T probably damaging Het
Ttn T A 2: 76,778,554 D17706V probably damaging Het
Uimc1 T C 13: 55,075,631 Y276C probably damaging Het
Usp24 T A 4: 106,379,079 I988K probably damaging Het
Vmn2r74 T A 7: 85,957,071 R356* probably null Het
Wdr37 A T 13: 8,819,935 H429Q probably damaging Het
Wwc2 A T 8: 47,880,150 L277Q probably damaging Het
Zscan12 T A 13: 21,368,586 N193K possibly damaging Het
Other mutations in Fam98a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Fam98a APN 17 75551747 missense probably damaging 1.00
IGL00548:Fam98a APN 17 75538818 missense probably damaging 1.00
IGL02170:Fam98a APN 17 75540192 critical splice acceptor site probably null
IGL02399:Fam98a APN 17 75538941 splice site probably benign
IGL03062:Fam98a APN 17 75540105 splice site probably benign
IGL03246:Fam98a APN 17 75538853 missense probably damaging 0.99
R0584:Fam98a UTSW 17 75544777 missense probably damaging 1.00
R0594:Fam98a UTSW 17 75538487 nonsense probably null
R1121:Fam98a UTSW 17 75538534 missense unknown
R1366:Fam98a UTSW 17 75539386 splice site probably benign
R1387:Fam98a UTSW 17 75538269 missense unknown
R1424:Fam98a UTSW 17 75540178 missense probably damaging 1.00
R1533:Fam98a UTSW 17 75541281 missense probably damaging 1.00
R1651:Fam98a UTSW 17 75547715 missense probably benign 0.16
R2211:Fam98a UTSW 17 75538945 critical splice donor site probably null
R4295:Fam98a UTSW 17 75541347 missense probably damaging 1.00
R4350:Fam98a UTSW 17 75541225 missense probably damaging 1.00
R4963:Fam98a UTSW 17 75538982 missense probably damaging 0.99
R5320:Fam98a UTSW 17 75538815 missense probably damaging 1.00
R5383:Fam98a UTSW 17 75538581 missense unknown
R6031:Fam98a UTSW 17 75539432 missense probably damaging 0.98
R6031:Fam98a UTSW 17 75539432 missense probably damaging 0.98
R7058:Fam98a UTSW 17 75538389 missense unknown
R7182:Fam98a UTSW 17 75539018 nonsense probably null
R7554:Fam98a UTSW 17 75547675 nonsense probably null
R7566:Fam98a UTSW 17 75547662 missense probably damaging 1.00
R8095:Fam98a UTSW 17 75538771 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCAAATGGTTATCCTAAGC -3'
(R):5'- TATACAGGAAGTGGCTACCAGG -3'

Sequencing Primer
(F):5'- TGCTACCTGTGGTCTTAC -3'
(R):5'- TGGATACCAGCAAGACAATAGATAC -3'
Posted On2019-10-17