Incidental Mutation 'R7505:Sec31b'
ID581767
Institutional Source Beutler Lab
Gene Symbol Sec31b
Ensembl Gene ENSMUSG00000051984
Gene NameSec31 homolog B (S. cerevisiae)
SynonymsLOC240667, Sec31l2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R7505 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location44516957-44545864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44543707 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 25 (A25T)
Ref Sequence ENSEMBL: ENSMUSP00000064900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063632] [ENSMUST00000111985] [ENSMUST00000171415]
Predicted Effect probably damaging
Transcript: ENSMUST00000063632
AA Change: A25T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064900
Gene: ENSMUSG00000051984
AA Change: A25T

DomainStartEndE-ValueType
Blast:WD40 56 101 5e-18 BLAST
WD40 110 150 4.76e-6 SMART
WD40 159 197 1.53e1 SMART
WD40 200 245 1.85e0 SMART
WD40 249 289 2.15e-4 SMART
WD40 292 332 6.19e-1 SMART
low complexity region 551 561 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 909 929 N/A INTRINSIC
low complexity region 1009 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111985
SMART Domains Protein: ENSMUSP00000107616
Gene: ENSMUSG00000051984

DomainStartEndE-ValueType
WD40 2 40 1.53e1 SMART
WD40 43 88 1.85e0 SMART
WD40 92 132 2.15e-4 SMART
WD40 135 175 6.19e-1 SMART
Pfam:Sec16_C 394 612 1.3e-7 PFAM
low complexity region 665 684 N/A INTRINSIC
low complexity region 752 772 N/A INTRINSIC
low complexity region 852 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166808
SMART Domains Protein: ENSMUSP00000126763
Gene: ENSMUSG00000091471

DomainStartEndE-ValueType
Pfam:NDUF_B8 1 71 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171415
SMART Domains Protein: ENSMUSP00000128192
Gene: ENSMUSG00000025204

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
Pfam:NDUF_B8 15 157 2.9e-67 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. The protein has moderate similarity to rat VAP1 protein which is an endosomal membrane-associated protein, containing a putative Ca2+/calmodulin-dependent kinase II phosphorylation site. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 T A 15: 91,149,057 N719Y possibly damaging Het
Adamts2 T C 11: 50,796,520 I1058T probably benign Het
Alb T A 5: 90,469,509 Y356N probably damaging Het
Ankrd52 A G 10: 128,390,055 N971D probably damaging Het
Atp6v1c2 A G 12: 17,297,723 probably null Het
Atp6v1h A T 1: 5,124,338 I247L probably benign Het
Cacna1s C T 1: 136,085,449 R593* probably null Het
Cacna2d3 C T 14: 29,045,544 probably null Het
Cdh15 G A 8: 122,848,492 G2D probably benign Het
Cebpe G T 14: 54,710,656 N243K probably damaging Het
Celf2 A T 2: 6,624,700 M136K probably damaging Het
Cep290 A G 10: 100,516,265 I778V probably benign Het
Col22a1 A T 15: 71,799,399 C1592* probably null Het
Cpne2 A T 8: 94,548,466 N34I possibly damaging Het
Cps1 A G 1: 67,180,081 N860S probably benign Het
Disp2 T G 2: 118,791,088 L767R probably damaging Het
Evpl A G 11: 116,226,987 probably null Het
F7 A T 8: 13,028,745 N59Y possibly damaging Het
Fam198a G C 9: 121,976,417 G425R probably benign Het
Fam98a A T 17: 75,538,238 H504Q unknown Het
Fbxo4 G A 15: 3,971,421 R270C probably benign Het
Fcgbp T C 7: 28,089,674 V555A probably damaging Het
Fgf4 T C 7: 144,861,761 V86A possibly damaging Het
Fpgt G T 3: 155,086,776 A538D possibly damaging Het
Gars A G 6: 55,052,177 T181A probably benign Het
Gbx2 A G 1: 89,928,733 S312P probably benign Het
Gm13101 C T 4: 143,964,986 C389Y probably benign Het
Gm21319 A T 12: 87,773,500 N96K probably benign Het
Gm29735 C T 7: 142,156,590 C175Y unknown Het
Gm7995 A G 14: 42,310,357 T49A Het
Gm8879 T A 5: 11,131,168 Y141N possibly damaging Het
Hnrnpk A G 13: 58,399,969 M27T probably benign Het
Idh3b A G 2: 130,284,227 S20P probably benign Het
Idh3b G C 2: 130,284,233 R18G probably benign Het
Ighg2b T A 12: 113,304,980 T354S Het
Lrfn2 T A 17: 49,096,451 M534K probably benign Het
Mcpt8 G A 14: 56,083,091 A127V probably benign Het
Msi2 A T 11: 88,413,917 N176K possibly damaging Het
Mtr G T 13: 12,221,476 D621E probably benign Het
Nlrp5 T A 7: 23,407,500 I63N probably benign Het
Nol6 T C 4: 41,120,352 D455G probably damaging Het
Nrde2 A T 12: 100,132,498 S637T probably benign Het
Ntn4 G T 10: 93,707,284 G291W probably damaging Het
Olfr1425 T A 19: 12,074,605 E9V possibly damaging Het
Olfr61 C A 7: 140,638,052 T117K probably damaging Het
Otof T A 5: 30,371,020 T1865S probably benign Het
Papd7 G T 13: 69,506,928 P476T probably damaging Het
Plec A T 15: 76,181,194 S1559T unknown Het
Plekhm1 C T 11: 103,380,029 probably null Het
Plin4 T A 17: 56,109,357 Q49L possibly damaging Het
Polrmt A G 10: 79,737,883 F995L probably benign Het
Polrmt A G 10: 79,743,176 probably null Het
Pramef25 A G 4: 143,949,703 I277T possibly damaging Het
Rims1 T C 1: 22,533,996 T375A possibly damaging Het
Ryr3 A T 2: 112,712,429 M3145K probably damaging Het
S100a11 A G 3: 93,526,032 K61R probably benign Het
Sar1a A G 10: 61,691,294 T164A probably benign Het
Smpd2 A G 10: 41,487,354 V371A probably benign Het
Spg11 A T 2: 122,075,351 L1271* probably null Het
Svep1 T C 4: 58,115,862 T944A possibly damaging Het
Taf6 A T 5: 138,179,945 C431* probably null Het
Tdrd6 A G 17: 43,627,679 V826A not run Het
Tmem132a A G 19: 10,858,673 V831A probably damaging Het
Tnfrsf8 T G 4: 145,269,115 D458A probably damaging Het
Trpv5 A G 6: 41,674,656 I196T probably damaging Het
Ttn T A 2: 76,778,554 D17706V probably damaging Het
Uimc1 T C 13: 55,075,631 Y276C probably damaging Het
Usp24 T A 4: 106,379,079 I988K probably damaging Het
Vmn2r74 T A 7: 85,957,071 R356* probably null Het
Wdr37 A T 13: 8,819,935 H429Q probably damaging Het
Wwc2 A T 8: 47,880,150 L277Q probably damaging Het
Zscan12 T A 13: 21,368,586 N193K possibly damaging Het
Other mutations in Sec31b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Sec31b APN 19 44527041 missense probably damaging 1.00
IGL01308:Sec31b APN 19 44523683 missense probably benign 0.02
IGL02404:Sec31b APN 19 44534788 missense probably damaging 0.99
IGL02663:Sec31b APN 19 44534278 missense probably damaging 1.00
IGL02728:Sec31b APN 19 44523115 missense probably damaging 0.96
IGL02830:Sec31b APN 19 44531703 missense probably damaging 1.00
IGL03141:Sec31b APN 19 44526320 splice site probably benign
IGL03247:Sec31b APN 19 44518940 missense possibly damaging 0.62
R0049:Sec31b UTSW 19 44520408 splice site probably benign
R0137:Sec31b UTSW 19 44534382 missense probably damaging 1.00
R0238:Sec31b UTSW 19 44525469 unclassified probably benign
R0239:Sec31b UTSW 19 44525469 unclassified probably benign
R0468:Sec31b UTSW 19 44518508 splice site probably benign
R0504:Sec31b UTSW 19 44534786 missense probably damaging 1.00
R0565:Sec31b UTSW 19 44524553 missense probably damaging 1.00
R0627:Sec31b UTSW 19 44525607 missense probably benign
R0749:Sec31b UTSW 19 44524506 missense probably damaging 0.96
R0815:Sec31b UTSW 19 44518173 nonsense probably null
R1162:Sec31b UTSW 19 44517648 nonsense probably null
R1398:Sec31b UTSW 19 44523665 missense probably benign 0.04
R1436:Sec31b UTSW 19 44536195 missense probably damaging 0.99
R1538:Sec31b UTSW 19 44518586 missense probably benign 0.42
R1599:Sec31b UTSW 19 44523153 missense possibly damaging 0.92
R2044:Sec31b UTSW 19 44536156 missense probably benign 0.07
R2135:Sec31b UTSW 19 44534696 missense probably damaging 0.99
R2167:Sec31b UTSW 19 44543353 missense possibly damaging 0.89
R2211:Sec31b UTSW 19 44523150 missense probably damaging 1.00
R2938:Sec31b UTSW 19 44536179 missense probably damaging 0.99
R3113:Sec31b UTSW 19 44518185 nonsense probably null
R4110:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4111:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4113:Sec31b UTSW 19 44524529 missense possibly damaging 0.62
R4158:Sec31b UTSW 19 44525186 missense probably benign 0.34
R4226:Sec31b UTSW 19 44531710 missense probably benign
R4646:Sec31b UTSW 19 44526621 missense probably benign 0.00
R4732:Sec31b UTSW 19 44532677 missense probably damaging 1.00
R4733:Sec31b UTSW 19 44532677 missense probably damaging 1.00
R4795:Sec31b UTSW 19 44531746 missense probably benign 0.00
R4877:Sec31b UTSW 19 44535733 missense probably damaging 1.00
R5150:Sec31b UTSW 19 44520531 missense probably benign 0.08
R5377:Sec31b UTSW 19 44518637 missense probably damaging 1.00
R5381:Sec31b UTSW 19 44534371 missense probably damaging 1.00
R5708:Sec31b UTSW 19 44523144 missense probably damaging 1.00
R6002:Sec31b UTSW 19 44535764 missense probably benign 0.04
R6185:Sec31b UTSW 19 44543284 missense possibly damaging 0.77
R6675:Sec31b UTSW 19 44523775 missense probably benign
R6946:Sec31b UTSW 19 44534316 missense probably damaging 1.00
R7139:Sec31b UTSW 19 44518936 missense probably benign 0.00
R7237:Sec31b UTSW 19 44517708 missense probably damaging 1.00
R7270:Sec31b UTSW 19 44523043 missense probably benign 0.00
R7340:Sec31b UTSW 19 44528722 missense probably benign 0.00
R7584:Sec31b UTSW 19 44543323 missense probably damaging 0.99
R7584:Sec31b UTSW 19 44531556 intron probably null
R7763:Sec31b UTSW 19 44523835 critical splice acceptor site probably null
R7777:Sec31b UTSW 19 44523773 nonsense probably null
R7900:Sec31b UTSW 19 44526230 missense probably damaging 1.00
R7983:Sec31b UTSW 19 44526230 missense probably damaging 1.00
R8057:Sec31b UTSW 19 44519365 missense probably damaging 1.00
RF023:Sec31b UTSW 19 44535787 missense probably damaging 1.00
Z1177:Sec31b UTSW 19 44517314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCTCTAGAGGTAACCGCAAG -3'
(R):5'- TGCTGGACTACTTCATCTTGTAGAG -3'

Sequencing Primer
(F):5'- CGCAAGGAAAGCATGAGGTG -3'
(R):5'- CTTCATCTTGTAGAGAAGAGAGACC -3'
Posted On2019-10-17