Incidental Mutation 'R7506:Mgat5'
ID 581769
Institutional Source Beutler Lab
Gene Symbol Mgat5
Ensembl Gene ENSMUSG00000036155
Gene Name mannoside acetylglucosaminyltransferase 5
Synonyms 4930471A21Rik, 5330407H02Rik, GlcNAc-TV, beta1,6N-acetylglucosaminyltransferase V
MMRRC Submission 045579-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7506 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 127132450-127413760 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 127294192 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 178 (D178A)
Ref Sequence ENSEMBL: ENSMUSP00000038359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038361] [ENSMUST00000171405]
AlphaFold Q8R4G6
Predicted Effect probably benign
Transcript: ENSMUST00000038361
AA Change: D178A

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038359
Gene: ENSMUSG00000036155
AA Change: D178A

DomainStartEndE-ValueType
Pfam:DUF4525 2 138 3.4e-70 PFAM
Pfam:Glyco_transf_18 171 725 9.8e-268 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171405
AA Change: D178A

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129166
Gene: ENSMUSG00000036155
AA Change: D178A

DomainStartEndE-ValueType
Pfam:DUF4525 3 137 9.3e-64 PFAM
Pfam:Glyco_transf_18 171 725 1.9e-268 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It catalyzes the addition of beta-1,6-N-acetylglucosamine to the alpha-linked mannose of biantennary N-linked oligosaccharides present on the newly synthesized glycoproteins. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. Alterations of the oligosaccharides on cell surface glycoproteins cause significant changes in the adhesive or migratory behavior of a cell. Increase in the activity of this enzyme has been correlated with the progression of invasive malignancies. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for deficiencies in this gene have immune system abnormalities and reduced cancer growth and metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,209,202 (GRCm39) V31I probably benign Het
4933430I17Rik T C 4: 62,450,498 (GRCm39) V24A possibly damaging Het
Adamtsl3 A T 7: 82,164,186 (GRCm39) R334W probably damaging Het
Aox1 G A 1: 58,088,562 (GRCm39) C116Y probably damaging Het
B3gntl1 A T 11: 121,561,740 (GRCm39) I74N probably damaging Het
Bicra C T 7: 15,722,138 (GRCm39) V460M possibly damaging Het
Ccdc18 G A 5: 108,311,605 (GRCm39) C437Y possibly damaging Het
Cdh6 A G 15: 13,034,396 (GRCm39) S755P probably damaging Het
Crtc2 G T 3: 90,166,519 (GRCm39) A165S probably damaging Het
Cwf19l2 C T 9: 3,456,775 (GRCm39) H703Y probably damaging Het
Cyc1 C A 15: 76,227,885 (GRCm39) T41K probably benign Het
Defb28 A T 2: 152,360,221 (GRCm39) H12L possibly damaging Het
Dsg3 T A 18: 20,666,521 (GRCm39) C577S probably benign Het
Ggt6 G T 11: 72,328,724 (GRCm39) C408F possibly damaging Het
Gm3278 T A 14: 16,080,479 (GRCm39) Y97N probably damaging Het
Gpr155 A G 2: 73,198,683 (GRCm39) L412P probably damaging Het
Gucd1 T C 10: 75,347,019 (GRCm39) H77R probably benign Het
H2bc8 G A 13: 23,755,658 (GRCm39) A18T unknown Het
Hat1 T A 2: 71,250,691 (GRCm39) I158N probably damaging Het
Hhla1 C T 15: 65,808,231 (GRCm39) W271* probably null Het
Igsf10 T A 3: 59,226,775 (GRCm39) L2299F probably damaging Het
Iqsec1 A G 6: 90,644,891 (GRCm39) S914P probably damaging Het
Iqsec1 G T 6: 90,639,788 (GRCm39) H983Q possibly damaging Het
Irx2 G T 13: 72,777,328 (GRCm39) G50C probably damaging Het
Kif26b T C 1: 178,357,064 (GRCm39) probably benign Het
Lmo7 A G 14: 102,157,045 (GRCm39) E1405G unknown Het
Mdm2 T C 10: 117,526,596 (GRCm39) D330G possibly damaging Het
Mier2 C A 10: 79,386,176 (GRCm39) R25L probably benign Het
Mlip T C 9: 77,072,085 (GRCm39) K257E probably damaging Het
Mtfr2 T C 10: 20,229,131 (GRCm39) S80P probably benign Het
Ndst2 A G 14: 20,780,153 (GRCm39) V29A probably benign Het
Negr1 T G 3: 156,774,870 (GRCm39) Y195* probably null Het
Nptn T C 9: 58,526,156 (GRCm39) L101P probably damaging Het
Nrip1 G A 16: 76,091,347 (GRCm39) T70I probably damaging Het
Nrtn C T 17: 57,058,633 (GRCm39) V123M probably damaging Het
Onecut1 T A 9: 74,770,522 (GRCm39) F315Y possibly damaging Het
Or1p1 A T 11: 74,179,949 (GRCm39) H159L possibly damaging Het
P4htm A G 9: 108,460,878 (GRCm39) L198S probably damaging Het
Pappa A C 4: 65,149,419 (GRCm39) I920L probably benign Het
Pcdhgb5 A C 18: 37,865,525 (GRCm39) D440A probably damaging Het
Ppard A T 17: 28,517,735 (GRCm39) N268Y possibly damaging Het
Rapgef6 T A 11: 54,526,997 (GRCm39) S563T probably benign Het
Rtn3 T A 19: 7,407,118 (GRCm39) E949D probably benign Het
Sf3a1 T C 11: 4,127,561 (GRCm39) M629T probably benign Het
Slc39a8 T C 3: 135,590,067 (GRCm39) I319T probably benign Het
Sorcs1 C T 19: 50,171,112 (GRCm39) W925* probably null Het
Spag9 G A 11: 93,999,290 (GRCm39) D1069N probably damaging Het
Taar7a A G 10: 23,868,892 (GRCm39) V163A possibly damaging Het
Tmem150a G A 6: 72,333,753 (GRCm39) probably null Het
Tnxb G A 17: 34,934,665 (GRCm39) V2425I possibly damaging Het
Tppp2 A G 14: 52,158,058 (GRCm39) K168E possibly damaging Het
Ttn T A 2: 76,719,812 (GRCm39) D7099V unknown Het
Vmn1r41 A T 6: 89,724,159 (GRCm39) R50* probably null Het
Vmn1r60 T C 7: 5,547,861 (GRCm39) K80E Het
Vmn2r18 A G 5: 151,508,485 (GRCm39) F213S possibly damaging Het
Vmn2r26 G A 6: 124,016,700 (GRCm39) S388N probably benign Het
Vmn2r63 A T 7: 42,576,391 (GRCm39) F474Y probably damaging Het
Zc3hav1 G A 6: 38,309,875 (GRCm39) R316* probably null Het
Zfp654 A T 16: 64,612,211 (GRCm39) I225N probably damaging Het
Zfp97 A G 17: 17,365,542 (GRCm39) E347G probably damaging Het
Other mutations in Mgat5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Mgat5 APN 1 127,315,204 (GRCm39) missense probably damaging 1.00
IGL00813:Mgat5 APN 1 127,312,543 (GRCm39) missense probably benign
IGL01795:Mgat5 APN 1 127,396,968 (GRCm39) missense probably damaging 0.98
IGL01830:Mgat5 APN 1 127,339,869 (GRCm39) missense probably damaging 1.00
IGL01879:Mgat5 APN 1 127,325,287 (GRCm39) missense probably damaging 0.99
IGL02322:Mgat5 APN 1 127,310,722 (GRCm39) missense probably benign 0.00
IGL02621:Mgat5 APN 1 127,325,326 (GRCm39) missense possibly damaging 0.86
IGL02695:Mgat5 APN 1 127,339,868 (GRCm39) missense probably damaging 1.00
IGL03142:Mgat5 APN 1 127,339,960 (GRCm39) missense probably damaging 1.00
Cowlick UTSW 1 127,399,301 (GRCm39) missense probably benign 0.36
Curls UTSW 1 127,248,371 (GRCm39) missense possibly damaging 0.77
R0518:Mgat5 UTSW 1 127,312,584 (GRCm39) missense probably damaging 1.00
R0594:Mgat5 UTSW 1 127,339,985 (GRCm39) missense probably damaging 0.96
R1480:Mgat5 UTSW 1 127,387,716 (GRCm39) missense probably damaging 1.00
R1501:Mgat5 UTSW 1 127,325,378 (GRCm39) critical splice donor site probably null
R1712:Mgat5 UTSW 1 127,248,375 (GRCm39) missense probably benign 0.34
R1744:Mgat5 UTSW 1 127,407,206 (GRCm39) missense probably damaging 1.00
R1862:Mgat5 UTSW 1 127,387,706 (GRCm39) missense probably damaging 1.00
R1994:Mgat5 UTSW 1 127,387,696 (GRCm39) missense possibly damaging 0.82
R2054:Mgat5 UTSW 1 127,325,344 (GRCm39) missense probably damaging 1.00
R2150:Mgat5 UTSW 1 127,396,987 (GRCm39) missense probably damaging 1.00
R2303:Mgat5 UTSW 1 127,374,036 (GRCm39) missense probably benign 0.00
R2566:Mgat5 UTSW 1 127,234,741 (GRCm39) missense probably benign 0.01
R3498:Mgat5 UTSW 1 127,312,571 (GRCm39) missense possibly damaging 0.55
R3788:Mgat5 UTSW 1 127,294,180 (GRCm39) missense probably benign
R4674:Mgat5 UTSW 1 127,318,495 (GRCm39) missense probably damaging 1.00
R4873:Mgat5 UTSW 1 127,396,986 (GRCm39) missense probably damaging 1.00
R4875:Mgat5 UTSW 1 127,396,986 (GRCm39) missense probably damaging 1.00
R5175:Mgat5 UTSW 1 127,387,649 (GRCm39) missense probably damaging 0.97
R5310:Mgat5 UTSW 1 127,315,251 (GRCm39) critical splice donor site probably null
R5337:Mgat5 UTSW 1 127,387,658 (GRCm39) missense possibly damaging 0.84
R5597:Mgat5 UTSW 1 127,325,303 (GRCm39) missense probably damaging 1.00
R5599:Mgat5 UTSW 1 127,325,303 (GRCm39) missense probably damaging 1.00
R5861:Mgat5 UTSW 1 127,315,129 (GRCm39) missense probably damaging 1.00
R5956:Mgat5 UTSW 1 127,310,676 (GRCm39) missense probably benign 0.10
R6042:Mgat5 UTSW 1 127,387,636 (GRCm39) missense probably damaging 1.00
R6223:Mgat5 UTSW 1 127,310,716 (GRCm39) missense possibly damaging 0.86
R6492:Mgat5 UTSW 1 127,399,301 (GRCm39) missense probably benign 0.36
R6662:Mgat5 UTSW 1 127,396,974 (GRCm39) missense probably damaging 1.00
R6960:Mgat5 UTSW 1 127,248,371 (GRCm39) missense possibly damaging 0.77
R6981:Mgat5 UTSW 1 127,318,588 (GRCm39) missense probably damaging 0.98
R7110:Mgat5 UTSW 1 127,310,716 (GRCm39) missense possibly damaging 0.92
R7133:Mgat5 UTSW 1 127,292,926 (GRCm39) missense probably benign
R7142:Mgat5 UTSW 1 127,339,924 (GRCm39) missense probably damaging 1.00
R7151:Mgat5 UTSW 1 127,373,999 (GRCm39) missense probably damaging 0.97
R7790:Mgat5 UTSW 1 127,339,941 (GRCm39) missense probably benign 0.23
R7980:Mgat5 UTSW 1 127,407,248 (GRCm39) missense probably benign 0.13
R8548:Mgat5 UTSW 1 127,248,409 (GRCm39) missense possibly damaging 0.77
R9008:Mgat5 UTSW 1 127,407,308 (GRCm39) missense probably damaging 1.00
R9127:Mgat5 UTSW 1 127,294,197 (GRCm39) missense probably benign 0.14
R9279:Mgat5 UTSW 1 127,325,348 (GRCm39) missense probably damaging 1.00
R9599:Mgat5 UTSW 1 127,248,445 (GRCm39) missense probably benign 0.02
X0028:Mgat5 UTSW 1 127,294,222 (GRCm39) missense possibly damaging 0.91
Z1177:Mgat5 UTSW 1 127,410,429 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGCATCTGGAACTCTCC -3'
(R):5'- CTTTATGGGACGGTGTCAGAGC -3'

Sequencing Primer
(F):5'- GATCTGAGCATCTGGTCACC -3'
(R):5'- TCAGAGCAAAGTGAGATGTCGC -3'
Posted On 2019-10-17