Incidental Mutation 'R7506:Hat1'
ID581771
Institutional Source Beutler Lab
Gene Symbol Hat1
Ensembl Gene ENSMUSG00000027018
Gene Namehistone aminotransferase 1
Synonyms2410071B14Rik, KAT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R7506 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location71388958-71441622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71420347 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 158 (I158N)
Ref Sequence ENSEMBL: ENSMUSP00000028408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028408] [ENSMUST00000112122]
Predicted Effect probably damaging
Transcript: ENSMUST00000028408
AA Change: I158N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028408
Gene: ENSMUSG00000027018
AA Change: I158N

DomainStartEndE-ValueType
Pfam:Hat1_N 23 184 1.3e-49 PFAM
coiled coil region 386 416 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112122
AA Change: I158N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107750
Gene: ENSMUSG00000027018
AA Change: I158N

DomainStartEndE-ValueType
Pfam:Hat1_N 22 184 4.4e-49 PFAM
coiled coil region 393 423 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type B histone acetyltransferase (HAT) that is involved in the rapid acetylation of newly synthesized cytoplasmic histones, which are in turn imported into the nucleus for de novo deposition onto nascent DNA chains. Histone acetylation, particularly of histone H4, plays an important role in replication-dependent chromatin assembly. Specifically, this HAT can acetylate soluble but not nucleosomal histone H4 at lysines 5 and 12, and to a lesser degree, histone H2A at lysine 5. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal, perinatal and neonatal lethality with impaired lung maturation, atelectasis, respiratory failure, craniofacial defects and decreased proliferation of mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,297,906 V31I probably benign Het
4933430I17Rik T C 4: 62,532,261 V24A possibly damaging Het
Adamtsl3 A T 7: 82,514,978 R334W probably damaging Het
Aox1 G A 1: 58,049,403 C116Y probably damaging Het
B3gntl1 A T 11: 121,670,914 I74N probably damaging Het
Bicra C T 7: 15,988,213 V460M possibly damaging Het
Ccdc18 G A 5: 108,163,739 C437Y possibly damaging Het
Cdh6 A G 15: 13,034,310 S755P probably damaging Het
Crtc2 G T 3: 90,259,212 A165S probably damaging Het
Cwf19l2 C T 9: 3,456,775 H703Y probably damaging Het
Cyc1 C A 15: 76,343,685 T41K probably benign Het
Defb28 A T 2: 152,518,301 H12L possibly damaging Het
Dsg3 T A 18: 20,533,464 C577S probably benign Het
Ggt6 G T 11: 72,437,898 C408F possibly damaging Het
Gm3278 T A 14: 4,893,441 Y97N probably damaging Het
Gpr155 A G 2: 73,368,339 L412P probably damaging Het
Gucd1 T C 10: 75,511,185 H77R probably benign Het
Hhla1 C T 15: 65,936,382 W271* probably null Het
Hist1h2bg G A 13: 23,571,484 A18T unknown Het
Igsf10 T A 3: 59,319,354 L2299F probably damaging Het
Iqsec1 G T 6: 90,662,806 H983Q possibly damaging Het
Iqsec1 A G 6: 90,667,909 S914P probably damaging Het
Irx2 G T 13: 72,629,209 G50C probably damaging Het
Kif26b T C 1: 178,529,499 probably benign Het
Lmo7 A G 14: 101,919,609 E1405G unknown Het
Mdm2 T C 10: 117,690,691 D330G possibly damaging Het
Mgat5 A C 1: 127,366,455 D178A probably benign Het
Mier2 C A 10: 79,550,342 R25L probably benign Het
Mlip T C 9: 77,164,803 K257E probably damaging Het
Mtfr2 T C 10: 20,353,385 S80P probably benign Het
Ndst2 A G 14: 20,730,085 V29A probably benign Het
Negr1 T G 3: 157,069,233 Y195* probably null Het
Nptn T C 9: 58,618,873 L101P probably damaging Het
Nrip1 G A 16: 76,294,459 T70I probably damaging Het
Nrtn C T 17: 56,751,633 V123M probably damaging Het
Olfr59 A T 11: 74,289,123 H159L possibly damaging Het
Onecut1 T A 9: 74,863,240 F315Y possibly damaging Het
P4htm A G 9: 108,583,679 L198S probably damaging Het
Pappa A C 4: 65,231,182 I920L probably benign Het
Pcdhgb5 A C 18: 37,732,472 D440A probably damaging Het
Ppard A T 17: 28,298,761 N268Y possibly damaging Het
Rapgef6 T A 11: 54,636,171 S563T probably benign Het
Rtn3 T A 19: 7,429,753 E949D probably benign Het
Sf3a1 T C 11: 4,177,561 M629T probably benign Het
Slc39a8 T C 3: 135,884,306 I319T probably benign Het
Sorcs1 C T 19: 50,182,674 W925* probably null Het
Spag9 G A 11: 94,108,464 D1069N probably damaging Het
Taar7a A G 10: 23,992,994 V163A possibly damaging Het
Tmem150a G A 6: 72,356,770 probably null Het
Tnxb G A 17: 34,715,691 V2425I possibly damaging Het
Tppp2 A G 14: 51,920,601 K168E possibly damaging Het
Ttn T A 2: 76,889,468 D7099V unknown Het
Vmn1r41 A T 6: 89,747,177 R50* probably null Het
Vmn1r60 T C 7: 5,544,862 K80E Het
Vmn2r18 A G 5: 151,585,020 F213S possibly damaging Het
Vmn2r26 G A 6: 124,039,741 S388N probably benign Het
Vmn2r63 A T 7: 42,926,967 F474Y probably damaging Het
Zc3hav1 G A 6: 38,332,940 R316* probably null Het
Zfp654 A T 16: 64,791,848 I225N probably damaging Het
Zfp97 A G 17: 17,145,280 E347G probably damaging Het
Other mutations in Hat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02728:Hat1 APN 2 71421260 missense probably damaging 1.00
IGL02945:Hat1 APN 2 71420693 missense probably benign 0.01
IGL02796:Hat1 UTSW 2 71420356 critical splice donor site probably null
R0789:Hat1 UTSW 2 71421744 splice site probably benign
R0907:Hat1 UTSW 2 71420617 nonsense probably null
R1412:Hat1 UTSW 2 71420617 nonsense probably null
R1571:Hat1 UTSW 2 71434175 missense probably benign
R1868:Hat1 UTSW 2 71421283 nonsense probably null
R1981:Hat1 UTSW 2 71389977 missense probably benign 0.01
R2064:Hat1 UTSW 2 71410160 missense possibly damaging 0.71
R2089:Hat1 UTSW 2 71434034 missense probably benign 0.12
R2091:Hat1 UTSW 2 71434034 missense probably benign 0.12
R2091:Hat1 UTSW 2 71434034 missense probably benign 0.12
R4115:Hat1 UTSW 2 71441222 missense probably benign 0.01
R5579:Hat1 UTSW 2 71410238 missense possibly damaging 0.86
R5650:Hat1 UTSW 2 71434034 missense probably benign 0.12
R5681:Hat1 UTSW 2 71434209 splice site probably null
R5895:Hat1 UTSW 2 71409013 missense possibly damaging 0.67
R6075:Hat1 UTSW 2 71410241 missense probably benign 0.29
R6621:Hat1 UTSW 2 71421715 missense probably benign 0.00
R7155:Hat1 UTSW 2 71421251 missense possibly damaging 0.95
R7644:Hat1 UTSW 2 71410181 missense probably damaging 1.00
R8255:Hat1 UTSW 2 71409003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGCAGATGATGTTGAAGGC -3'
(R):5'- ACATGTCATGTCAGCCTAGG -3'

Sequencing Primer
(F):5'- TGTTGAAGGCAAAATCAGACAAATC -3'
(R):5'- CTGTAGAACACAAAACTATCCTGTGG -3'
Posted On2019-10-17