Incidental Mutation 'R7506:Crtc2'
ID581776
Institutional Source Beutler Lab
Gene Symbol Crtc2
Ensembl Gene ENSMUSG00000027936
Gene NameCREB regulated transcription coactivator 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.381) question?
Stock #R7506 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location90254163-90264125 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 90259212 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 165 (A165S)
Ref Sequence ENSEMBL: ENSMUSP00000029545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029545] [ENSMUST00000184882]
Predicted Effect probably damaging
Transcript: ENSMUST00000029545
AA Change: A165S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029545
Gene: ENSMUSG00000027936
AA Change: A165S

DomainStartEndE-ValueType
Pfam:TORC_N 18 72 1.8e-20 PFAM
low complexity region 127 141 N/A INTRINSIC
Pfam:TORC_M 168 323 3.7e-71 PFAM
low complexity region 335 384 N/A INTRINSIC
low complexity region 391 416 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 484 494 N/A INTRINSIC
low complexity region 517 528 N/A INTRINSIC
Pfam:TORC_C 614 691 4.3e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184882
AA Change: A80S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139194
Gene: ENSMUSG00000027936
AA Change: A80S

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:TORC_M 83 239 6.5e-65 PFAM
low complexity region 250 299 N/A INTRINSIC
low complexity region 306 331 N/A INTRINSIC
low complexity region 347 354 N/A INTRINSIC
low complexity region 399 409 N/A INTRINSIC
low complexity region 432 443 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transducers of regulated cAMP response element-binding protein activity family of transcription coactivators. These proteins promote the transcription of genes targeted by the cAMP response element-binding protein, and therefore play an important role in many cellular processes. Under basal conditions the encoded protein is phosphorylated by AMP-activated protein kinase or the salt-inducible kinases and is sequestered in the cytoplasm. Upon activation by elevated cAMP or calcium, the encoded protein translocates to the nucleus and increases target gene expression. Single nucleotide polymorphisms in this gene may increase the risk of type 2 diabetes. A pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating corticosterone levels, hepatocyte secretion of glucose in response to glucagon, and glycogen levels in liver and muscle cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,297,906 V31I probably benign Het
4933430I17Rik T C 4: 62,532,261 V24A possibly damaging Het
Adamtsl3 A T 7: 82,514,978 R334W probably damaging Het
Aox1 G A 1: 58,049,403 C116Y probably damaging Het
B3gntl1 A T 11: 121,670,914 I74N probably damaging Het
Bicra C T 7: 15,988,213 V460M possibly damaging Het
Ccdc18 G A 5: 108,163,739 C437Y possibly damaging Het
Cdh6 A G 15: 13,034,310 S755P probably damaging Het
Cwf19l2 C T 9: 3,456,775 H703Y probably damaging Het
Cyc1 C A 15: 76,343,685 T41K probably benign Het
Defb28 A T 2: 152,518,301 H12L possibly damaging Het
Dsg3 T A 18: 20,533,464 C577S probably benign Het
Ggt6 G T 11: 72,437,898 C408F possibly damaging Het
Gm3278 T A 14: 4,893,441 Y97N probably damaging Het
Gpr155 A G 2: 73,368,339 L412P probably damaging Het
Gucd1 T C 10: 75,511,185 H77R probably benign Het
Hat1 T A 2: 71,420,347 I158N probably damaging Het
Hhla1 C T 15: 65,936,382 W271* probably null Het
Hist1h2bg G A 13: 23,571,484 A18T unknown Het
Igsf10 T A 3: 59,319,354 L2299F probably damaging Het
Iqsec1 G T 6: 90,662,806 H983Q possibly damaging Het
Iqsec1 A G 6: 90,667,909 S914P probably damaging Het
Irx2 G T 13: 72,629,209 G50C probably damaging Het
Kif26b T C 1: 178,529,499 probably benign Het
Lmo7 A G 14: 101,919,609 E1405G unknown Het
Mdm2 T C 10: 117,690,691 D330G possibly damaging Het
Mgat5 A C 1: 127,366,455 D178A probably benign Het
Mier2 C A 10: 79,550,342 R25L probably benign Het
Mlip T C 9: 77,164,803 K257E probably damaging Het
Mtfr2 T C 10: 20,353,385 S80P probably benign Het
Ndst2 A G 14: 20,730,085 V29A probably benign Het
Negr1 T G 3: 157,069,233 Y195* probably null Het
Nptn T C 9: 58,618,873 L101P probably damaging Het
Nrip1 G A 16: 76,294,459 T70I probably damaging Het
Nrtn C T 17: 56,751,633 V123M probably damaging Het
Olfr59 A T 11: 74,289,123 H159L possibly damaging Het
Onecut1 T A 9: 74,863,240 F315Y possibly damaging Het
P4htm A G 9: 108,583,679 L198S probably damaging Het
Pappa A C 4: 65,231,182 I920L probably benign Het
Pcdhgb5 A C 18: 37,732,472 D440A probably damaging Het
Ppard A T 17: 28,298,761 N268Y possibly damaging Het
Rapgef6 T A 11: 54,636,171 S563T probably benign Het
Rtn3 T A 19: 7,429,753 E949D probably benign Het
Sf3a1 T C 11: 4,177,561 M629T probably benign Het
Slc39a8 T C 3: 135,884,306 I319T probably benign Het
Sorcs1 C T 19: 50,182,674 W925* probably null Het
Spag9 G A 11: 94,108,464 D1069N probably damaging Het
Taar7a A G 10: 23,992,994 V163A possibly damaging Het
Tmem150a G A 6: 72,356,770 probably null Het
Tnxb G A 17: 34,715,691 V2425I possibly damaging Het
Tppp2 A G 14: 51,920,601 K168E possibly damaging Het
Ttn T A 2: 76,889,468 D7099V unknown Het
Vmn1r41 A T 6: 89,747,177 R50* probably null Het
Vmn1r60 T C 7: 5,544,862 K80E Het
Vmn2r18 A G 5: 151,585,020 F213S possibly damaging Het
Vmn2r26 G A 6: 124,039,741 S388N probably benign Het
Vmn2r63 A T 7: 42,926,967 F474Y probably damaging Het
Zc3hav1 G A 6: 38,332,940 R316* probably null Het
Zfp654 A T 16: 64,791,848 I225N probably damaging Het
Zfp97 A G 17: 17,145,280 E347G probably damaging Het
Other mutations in Crtc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Crtc2 APN 3 90260805 missense probably damaging 0.98
IGL01874:Crtc2 APN 3 90258508 missense probably damaging 1.00
IGL02220:Crtc2 APN 3 90259148 splice site probably benign
IGL02454:Crtc2 APN 3 90259167 missense probably benign 0.00
IGL02957:Crtc2 APN 3 90262533 missense probably damaging 1.00
R0190:Crtc2 UTSW 3 90259409 missense probably damaging 1.00
R0492:Crtc2 UTSW 3 90263497 missense probably damaging 0.99
R0707:Crtc2 UTSW 3 90263497 missense probably damaging 0.99
R0751:Crtc2 UTSW 3 90262633 nonsense probably null
R1184:Crtc2 UTSW 3 90262633 nonsense probably null
R1521:Crtc2 UTSW 3 90257383 missense probably benign 0.10
R3856:Crtc2 UTSW 3 90262570 missense probably damaging 1.00
R4283:Crtc2 UTSW 3 90259236 splice site probably benign
R4747:Crtc2 UTSW 3 90260211 missense probably damaging 1.00
R5293:Crtc2 UTSW 3 90263564 missense probably benign
R5302:Crtc2 UTSW 3 90261018 missense probably damaging 1.00
R5314:Crtc2 UTSW 3 90261041 nonsense probably null
R6170:Crtc2 UTSW 3 90259600 missense probably benign
R6887:Crtc2 UTSW 3 90261071 missense probably damaging 0.99
R7067:Crtc2 UTSW 3 90260182 missense probably benign 0.44
R8169:Crtc2 UTSW 3 90263576 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTATGGATCAAGGGCATC -3'
(R):5'- CAGAGCTTGTCCTGTTGGAG -3'

Sequencing Primer
(F):5'- CTTATGGATCAAGGGCATCAGAAAAG -3'
(R):5'- TCCTGTTGGAGGAGTAGAAATG -3'
Posted On2019-10-17