Incidental Mutation 'R7506:Pappa'
ID581780
Institutional Source Beutler Lab
Gene Symbol Pappa
Ensembl Gene ENSMUSG00000028370
Gene Namepregnancy-associated plasma protein A
SynonymsIGFBP-4ase, PAPP-A, PAG1, 8430414N03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.723) question?
Stock #R7506 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location65124174-65357509 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 65231182 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 920 (I920L)
Ref Sequence ENSEMBL: ENSMUSP00000081545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084501]
Predicted Effect probably benign
Transcript: ENSMUST00000084501
AA Change: I920L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000081545
Gene: ENSMUSG00000028370
AA Change: I920L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 24 66 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
LamGL 114 263 1.55e-54 SMART
NL 396 438 4.15e-8 SMART
NL 441 471 6.73e-1 SMART
Pfam:Peptidase_M43 500 657 2.5e-10 PFAM
Blast:FN3 669 929 1e-165 BLAST
CCP 1212 1277 1.39e-9 SMART
CCP 1282 1339 1.08e-6 SMART
CCP 1343 1407 1.64e-6 SMART
CCP 1412 1468 8.06e-6 SMART
NL 1544 1581 3.24e-10 SMART
low complexity region 1584 1591 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are smaller than normal with delayed ossification, but are otherwise normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,297,906 V31I probably benign Het
4933430I17Rik T C 4: 62,532,261 V24A possibly damaging Het
Adamtsl3 A T 7: 82,514,978 R334W probably damaging Het
Aox1 G A 1: 58,049,403 C116Y probably damaging Het
B3gntl1 A T 11: 121,670,914 I74N probably damaging Het
Bicra C T 7: 15,988,213 V460M possibly damaging Het
Ccdc18 G A 5: 108,163,739 C437Y possibly damaging Het
Cdh6 A G 15: 13,034,310 S755P probably damaging Het
Crtc2 G T 3: 90,259,212 A165S probably damaging Het
Cwf19l2 C T 9: 3,456,775 H703Y probably damaging Het
Cyc1 C A 15: 76,343,685 T41K probably benign Het
Defb28 A T 2: 152,518,301 H12L possibly damaging Het
Dsg3 T A 18: 20,533,464 C577S probably benign Het
Ggt6 G T 11: 72,437,898 C408F possibly damaging Het
Gm3278 T A 14: 4,893,441 Y97N probably damaging Het
Gpr155 A G 2: 73,368,339 L412P probably damaging Het
Gucd1 T C 10: 75,511,185 H77R probably benign Het
Hat1 T A 2: 71,420,347 I158N probably damaging Het
Hhla1 C T 15: 65,936,382 W271* probably null Het
Hist1h2bg G A 13: 23,571,484 A18T unknown Het
Igsf10 T A 3: 59,319,354 L2299F probably damaging Het
Iqsec1 G T 6: 90,662,806 H983Q possibly damaging Het
Iqsec1 A G 6: 90,667,909 S914P probably damaging Het
Irx2 G T 13: 72,629,209 G50C probably damaging Het
Kif26b T C 1: 178,529,499 probably benign Het
Lmo7 A G 14: 101,919,609 E1405G unknown Het
Mdm2 T C 10: 117,690,691 D330G possibly damaging Het
Mgat5 A C 1: 127,366,455 D178A probably benign Het
Mier2 C A 10: 79,550,342 R25L probably benign Het
Mlip T C 9: 77,164,803 K257E probably damaging Het
Mtfr2 T C 10: 20,353,385 S80P probably benign Het
Ndst2 A G 14: 20,730,085 V29A probably benign Het
Negr1 T G 3: 157,069,233 Y195* probably null Het
Nptn T C 9: 58,618,873 L101P probably damaging Het
Nrip1 G A 16: 76,294,459 T70I probably damaging Het
Nrtn C T 17: 56,751,633 V123M probably damaging Het
Olfr59 A T 11: 74,289,123 H159L possibly damaging Het
Onecut1 T A 9: 74,863,240 F315Y possibly damaging Het
P4htm A G 9: 108,583,679 L198S probably damaging Het
Pcdhgb5 A C 18: 37,732,472 D440A probably damaging Het
Ppard A T 17: 28,298,761 N268Y possibly damaging Het
Rapgef6 T A 11: 54,636,171 S563T probably benign Het
Rtn3 T A 19: 7,429,753 E949D probably benign Het
Sf3a1 T C 11: 4,177,561 M629T probably benign Het
Slc39a8 T C 3: 135,884,306 I319T probably benign Het
Sorcs1 C T 19: 50,182,674 W925* probably null Het
Spag9 G A 11: 94,108,464 D1069N probably damaging Het
Taar7a A G 10: 23,992,994 V163A possibly damaging Het
Tmem150a G A 6: 72,356,770 probably null Het
Tnxb G A 17: 34,715,691 V2425I possibly damaging Het
Tppp2 A G 14: 51,920,601 K168E possibly damaging Het
Ttn T A 2: 76,889,468 D7099V unknown Het
Vmn1r41 A T 6: 89,747,177 R50* probably null Het
Vmn1r60 T C 7: 5,544,862 K80E Het
Vmn2r18 A G 5: 151,585,020 F213S possibly damaging Het
Vmn2r26 G A 6: 124,039,741 S388N probably benign Het
Vmn2r63 A T 7: 42,926,967 F474Y probably damaging Het
Zc3hav1 G A 6: 38,332,940 R316* probably null Het
Zfp654 A T 16: 64,791,848 I225N probably damaging Het
Zfp97 A G 17: 17,145,280 E347G probably damaging Het
Other mutations in Pappa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Pappa APN 4 65189316 missense probably damaging 1.00
IGL01340:Pappa APN 4 65323872 missense possibly damaging 0.49
IGL01482:Pappa APN 4 65156034 missense probably benign 0.18
IGL01485:Pappa APN 4 65189299 missense probably damaging 0.96
IGL01759:Pappa APN 4 65205158 splice site probably null
IGL01860:Pappa APN 4 65205092 missense possibly damaging 0.50
IGL01990:Pappa APN 4 65156687 splice site probably benign
IGL02089:Pappa APN 4 65156124 missense possibly damaging 0.75
IGL02153:Pappa APN 4 65297437 missense probably damaging 0.96
IGL02184:Pappa APN 4 65340691 missense possibly damaging 0.82
IGL02324:Pappa APN 4 65196808 missense probably damaging 0.99
IGL02542:Pappa APN 4 65176281 missense probably damaging 1.00
IGL02556:Pappa APN 4 65156626 missense possibly damaging 0.56
IGL02698:Pappa APN 4 65181020 missense probably damaging 1.00
IGL02903:Pappa APN 4 65261980 missense probably damaging 1.00
IGL02974:Pappa APN 4 65204935 missense probably damaging 1.00
IGL03107:Pappa APN 4 65204703 missense probably damaging 1.00
IGL03376:Pappa APN 4 65196834 missense probably benign 0.01
caer UTSW 4 65124891 missense probably damaging 0.98
Maennel UTSW 4 65314587 missense probably benign 0.05
maennelein UTSW 4 65314796 splice site probably null
mama UTSW 4 65204867 missense possibly damaging 0.94
untersuchen UTSW 4 65297257 missense probably damaging 1.00
IGL02980:Pappa UTSW 4 65307774 missense probably benign 0.25
PIT4498001:Pappa UTSW 4 65316232 missense probably damaging 1.00
R0077:Pappa UTSW 4 65307812 missense probably damaging 1.00
R0390:Pappa UTSW 4 65351613 splice site probably null
R0458:Pappa UTSW 4 65155882 missense probably damaging 1.00
R0883:Pappa UTSW 4 65189315 nonsense probably null
R0946:Pappa UTSW 4 65314792 critical splice donor site probably null
R1228:Pappa UTSW 4 65340689 missense probably damaging 1.00
R1327:Pappa UTSW 4 65351603 splice site probably benign
R1489:Pappa UTSW 4 65180948 missense possibly damaging 0.85
R1619:Pappa UTSW 4 65176229 missense probably damaging 1.00
R1856:Pappa UTSW 4 65340743 missense probably damaging 1.00
R2047:Pappa UTSW 4 65231141 splice site probably benign
R2102:Pappa UTSW 4 65316228 nonsense probably null
R2127:Pappa UTSW 4 65297257 missense probably damaging 1.00
R2143:Pappa UTSW 4 65180949 nonsense probably null
R2144:Pappa UTSW 4 65180949 nonsense probably null
R2166:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2167:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2168:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2178:Pappa UTSW 4 65351687 missense probably benign 0.00
R2504:Pappa UTSW 4 65180889 nonsense probably null
R4043:Pappa UTSW 4 65314587 missense probably benign 0.05
R4289:Pappa UTSW 4 65155863 missense probably benign 0.19
R4415:Pappa UTSW 4 65305295 missense probably benign 0.00
R4529:Pappa UTSW 4 65231182 missense probably benign
R4620:Pappa UTSW 4 65327028 missense probably benign 0.43
R4657:Pappa UTSW 4 65314796 splice site probably null
R4658:Pappa UTSW 4 65314796 splice site probably null
R5074:Pappa UTSW 4 65205128 missense probably benign 0.15
R5200:Pappa UTSW 4 65155839 missense probably damaging 1.00
R5420:Pappa UTSW 4 65335780 critical splice donor site probably null
R5469:Pappa UTSW 4 65205152 missense probably benign 0.01
R5651:Pappa UTSW 4 65156352 missense probably damaging 0.99
R5725:Pappa UTSW 4 65189410 missense probably damaging 1.00
R5941:Pappa UTSW 4 65314593 missense possibly damaging 0.52
R6002:Pappa UTSW 4 65297408 missense probably damaging 0.99
R6252:Pappa UTSW 4 65189412 missense probably benign 0.02
R6303:Pappa UTSW 4 65204654 missense probably damaging 1.00
R6322:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6431:Pappa UTSW 4 65156464 missense probably damaging 1.00
R6462:Pappa UTSW 4 65124891 missense probably damaging 0.98
R6484:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6537:Pappa UTSW 4 65297282 missense probably damaging 0.99
R6578:Pappa UTSW 4 65156137 missense possibly damaging 0.48
R6704:Pappa UTSW 4 65204924 missense probably damaging 1.00
R6789:Pappa UTSW 4 65181041 missense probably damaging 1.00
R7023:Pappa UTSW 4 65351718 missense probably benign 0.00
R7139:Pappa UTSW 4 65189450 missense probably benign 0.30
R7158:Pappa UTSW 4 65204867 missense possibly damaging 0.94
R7165:Pappa UTSW 4 65261873 missense probably damaging 1.00
R7196:Pappa UTSW 4 65323891 splice site probably null
R7410:Pappa UTSW 4 65335719 missense probably damaging 1.00
R7457:Pappa UTSW 4 65189266 missense probably damaging 1.00
R7546:Pappa UTSW 4 65156115 missense possibly damaging 0.48
R8111:Pappa UTSW 4 65261992 missense probably damaging 0.99
R8260:Pappa UTSW 4 65316182 missense probably damaging 0.99
RF006:Pappa UTSW 4 65323873 missense probably benign 0.00
RF020:Pappa UTSW 4 65205045 missense possibly damaging 0.77
X0058:Pappa UTSW 4 65156232 missense probably damaging 1.00
X0060:Pappa UTSW 4 65124941 missense probably benign 0.00
Z1177:Pappa UTSW 4 65307758 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGGCCTAGCAAAGTAGC -3'
(R):5'- TGGGGCTCATAAATTTTGGGATATC -3'

Sequencing Primer
(F):5'- CTGGGCCTAGCAAAGTAGCTTAAC -3'
(R):5'- GGGATATCTCCTAAGATCTGCTATTC -3'
Posted On2019-10-17