Incidental Mutation 'R7506:Zc3hav1'
ID581783
Institutional Source Beutler Lab
Gene Symbol Zc3hav1
Ensembl Gene ENSMUSG00000029826
Gene Namezinc finger CCCH type, antiviral 1
Synonyms9130009D18Rik, 2900058M19Rik, ZAP, 1200014N16Rik, 9830115L13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7506 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location38305286-38354603 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 38332940 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 316 (R316*)
Ref Sequence ENSEMBL: ENSMUSP00000144312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031850] [ENSMUST00000114898] [ENSMUST00000114900] [ENSMUST00000143702]
Predicted Effect probably null
Transcript: ENSMUST00000031850
AA Change: R316*
SMART Domains Protein: ENSMUSP00000031850
Gene: ENSMUSG00000029826
AA Change: R316*

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 9.6e-6 PROSPERO
internal_repeat_1 166 208 9.6e-6 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114898
AA Change: R316*
SMART Domains Protein: ENSMUSP00000110548
Gene: ENSMUSG00000029826
AA Change: R316*

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 8.18e-6 PROSPERO
internal_repeat_1 166 208 8.18e-6 PROSPERO
low complexity region 338 350 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114900
AA Change: R316*
SMART Domains Protein: ENSMUSP00000110550
Gene: ENSMUSG00000029826
AA Change: R316*

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 1.94e-5 PROSPERO
internal_repeat_1 166 208 1.94e-5 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Pfam:WWE 695 772 2.8e-15 PFAM
Pfam:PARP 817 986 1.3e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000143702
AA Change: R316*
SMART Domains Protein: ENSMUSP00000144312
Gene: ENSMUSG00000029826
AA Change: R316*

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
internal_repeat_1 80 127 1.8e-5 PROSPERO
internal_repeat_1 166 208 1.8e-5 PROSPERO
low complexity region 338 350 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
Pfam:WWE 695 772 1e-15 PFAM
Pfam:PARP 817 922 1.9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CCCH-type zinc finger protein that is thought to prevent infection by retroviruses. Studies of the rat homolog indicate that the protein may primarily function to inhibit viral gene expression and induce an innate immunity to viral infection. Alternative splicing occurs at this locus and two variants, each encoding distinct isoforms, are described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced murine leukemia virus replication efficiency in mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,297,906 V31I probably benign Het
4933430I17Rik T C 4: 62,532,261 V24A possibly damaging Het
Adamtsl3 A T 7: 82,514,978 R334W probably damaging Het
Aox1 G A 1: 58,049,403 C116Y probably damaging Het
B3gntl1 A T 11: 121,670,914 I74N probably damaging Het
Bicra C T 7: 15,988,213 V460M possibly damaging Het
Ccdc18 G A 5: 108,163,739 C437Y possibly damaging Het
Cdh6 A G 15: 13,034,310 S755P probably damaging Het
Crtc2 G T 3: 90,259,212 A165S probably damaging Het
Cwf19l2 C T 9: 3,456,775 H703Y probably damaging Het
Cyc1 C A 15: 76,343,685 T41K probably benign Het
Defb28 A T 2: 152,518,301 H12L possibly damaging Het
Dsg3 T A 18: 20,533,464 C577S probably benign Het
Ggt6 G T 11: 72,437,898 C408F possibly damaging Het
Gm3278 T A 14: 4,893,441 Y97N probably damaging Het
Gpr155 A G 2: 73,368,339 L412P probably damaging Het
Gucd1 T C 10: 75,511,185 H77R probably benign Het
Hat1 T A 2: 71,420,347 I158N probably damaging Het
Hhla1 C T 15: 65,936,382 W271* probably null Het
Hist1h2bg G A 13: 23,571,484 A18T unknown Het
Igsf10 T A 3: 59,319,354 L2299F probably damaging Het
Iqsec1 G T 6: 90,662,806 H983Q possibly damaging Het
Iqsec1 A G 6: 90,667,909 S914P probably damaging Het
Irx2 G T 13: 72,629,209 G50C probably damaging Het
Kif26b T C 1: 178,529,499 probably benign Het
Lmo7 A G 14: 101,919,609 E1405G unknown Het
Mdm2 T C 10: 117,690,691 D330G possibly damaging Het
Mgat5 A C 1: 127,366,455 D178A probably benign Het
Mier2 C A 10: 79,550,342 R25L probably benign Het
Mlip T C 9: 77,164,803 K257E probably damaging Het
Mtfr2 T C 10: 20,353,385 S80P probably benign Het
Ndst2 A G 14: 20,730,085 V29A probably benign Het
Negr1 T G 3: 157,069,233 Y195* probably null Het
Nptn T C 9: 58,618,873 L101P probably damaging Het
Nrip1 G A 16: 76,294,459 T70I probably damaging Het
Nrtn C T 17: 56,751,633 V123M probably damaging Het
Olfr59 A T 11: 74,289,123 H159L possibly damaging Het
Onecut1 T A 9: 74,863,240 F315Y possibly damaging Het
P4htm A G 9: 108,583,679 L198S probably damaging Het
Pappa A C 4: 65,231,182 I920L probably benign Het
Pcdhgb5 A C 18: 37,732,472 D440A probably damaging Het
Ppard A T 17: 28,298,761 N268Y possibly damaging Het
Rapgef6 T A 11: 54,636,171 S563T probably benign Het
Rtn3 T A 19: 7,429,753 E949D probably benign Het
Sf3a1 T C 11: 4,177,561 M629T probably benign Het
Slc39a8 T C 3: 135,884,306 I319T probably benign Het
Sorcs1 C T 19: 50,182,674 W925* probably null Het
Spag9 G A 11: 94,108,464 D1069N probably damaging Het
Taar7a A G 10: 23,992,994 V163A possibly damaging Het
Tmem150a G A 6: 72,356,770 probably null Het
Tnxb G A 17: 34,715,691 V2425I possibly damaging Het
Tppp2 A G 14: 51,920,601 K168E possibly damaging Het
Ttn T A 2: 76,889,468 D7099V unknown Het
Vmn1r41 A T 6: 89,747,177 R50* probably null Het
Vmn1r60 T C 7: 5,544,862 K80E Het
Vmn2r18 A G 5: 151,585,020 F213S possibly damaging Het
Vmn2r26 G A 6: 124,039,741 S388N probably benign Het
Vmn2r63 A T 7: 42,926,967 F474Y probably damaging Het
Zfp654 A T 16: 64,791,848 I225N probably damaging Het
Zfp97 A G 17: 17,145,280 E347G probably damaging Het
Other mutations in Zc3hav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Zc3hav1 APN 6 38319833 splice site probably null
IGL02225:Zc3hav1 APN 6 38340341 missense probably damaging 1.00
IGL02266:Zc3hav1 APN 6 38332168 missense probably benign 0.01
IGL02458:Zc3hav1 APN 6 38340329 missense probably damaging 1.00
IGL02626:Zc3hav1 APN 6 38332991 missense probably damaging 0.96
IGL02725:Zc3hav1 APN 6 38332192 missense probably damaging 0.98
IGL02958:Zc3hav1 APN 6 38332984 missense probably damaging 1.00
IGL03104:Zc3hav1 APN 6 38340343 missense probably damaging 1.00
IGL03137:Zc3hav1 APN 6 38332394 missense probably benign
IGL03238:Zc3hav1 APN 6 38332750 missense probably damaging 0.99
IGL03380:Zc3hav1 APN 6 38336558 missense probably damaging 1.00
IGL03055:Zc3hav1 UTSW 6 38316316 splice site probably null
P0038:Zc3hav1 UTSW 6 38332534 missense probably damaging 0.98
R0006:Zc3hav1 UTSW 6 38319702 critical splice donor site probably null
R0207:Zc3hav1 UTSW 6 38311174 missense probably benign 0.00
R0255:Zc3hav1 UTSW 6 38336550 missense probably damaging 1.00
R0452:Zc3hav1 UTSW 6 38307437 missense probably benign 0.01
R0505:Zc3hav1 UTSW 6 38332664 missense probably damaging 1.00
R0865:Zc3hav1 UTSW 6 38353902 splice site probably benign
R1281:Zc3hav1 UTSW 6 38353937 missense probably damaging 1.00
R1531:Zc3hav1 UTSW 6 38307235 missense possibly damaging 0.91
R1873:Zc3hav1 UTSW 6 38332757 missense possibly damaging 0.50
R1991:Zc3hav1 UTSW 6 38336517 missense probably damaging 1.00
R2149:Zc3hav1 UTSW 6 38336537 missense probably damaging 1.00
R2184:Zc3hav1 UTSW 6 38307408 missense probably damaging 0.99
R2365:Zc3hav1 UTSW 6 38340233 missense probably damaging 1.00
R2924:Zc3hav1 UTSW 6 38354110 missense probably damaging 0.97
R3237:Zc3hav1 UTSW 6 38319715 missense probably damaging 1.00
R3710:Zc3hav1 UTSW 6 38332162 missense probably benign 0.35
R5683:Zc3hav1 UTSW 6 38307237 missense probably damaging 1.00
R5684:Zc3hav1 UTSW 6 38311279 missense probably benign 0.01
R5905:Zc3hav1 UTSW 6 38307340 missense probably benign 0.03
R5959:Zc3hav1 UTSW 6 38307444 missense probably benign 0.01
R6028:Zc3hav1 UTSW 6 38307340 missense probably benign 0.03
R6261:Zc3hav1 UTSW 6 38333000 missense probably benign 0.24
R6465:Zc3hav1 UTSW 6 38331849 missense possibly damaging 0.85
R6682:Zc3hav1 UTSW 6 38325195 missense probably benign 0.02
R6831:Zc3hav1 UTSW 6 38332168 missense probably benign 0.01
R7082:Zc3hav1 UTSW 6 38332393 nonsense probably null
R7196:Zc3hav1 UTSW 6 38329272 missense probably benign
R7248:Zc3hav1 UTSW 6 38353976 missense probably benign 0.04
R7319:Zc3hav1 UTSW 6 38332274 missense probably benign
R7593:Zc3hav1 UTSW 6 38329186 missense probably benign 0.01
R7788:Zc3hav1 UTSW 6 38332756 missense probably benign 0.02
R7885:Zc3hav1 UTSW 6 38336663 missense possibly damaging 0.82
R7892:Zc3hav1 UTSW 6 38329221 missense probably benign 0.25
R8109:Zc3hav1 UTSW 6 38329179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCGATCAATGTCCTCGTTC -3'
(R):5'- CCATCACAACAGTCTAGAGGTTC -3'

Sequencing Primer
(F):5'- CTCGACGTGGTGTCCTGAAG -3'
(R):5'- ACAGTCTAGAGGTTCTCTCAACGG -3'
Posted On2019-10-17