Incidental Mutation 'R7506:Iqsec1'
ID581786
Institutional Source Beutler Lab
Gene Symbol Iqsec1
Ensembl Gene ENSMUSG00000034312
Gene NameIQ motif and Sec7 domain 1
SynonymsD6Ertd349e, cI-43, BRAG2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R7506 (G1)
Quality Score154.008
Status Validated
Chromosome6
Chromosomal Location90656088-90988685 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 90662806 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 983 (H983Q)
Ref Sequence ENSEMBL: ENSMUSP00000098710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101151] [ENSMUST00000101153] [ENSMUST00000212100]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101151
AA Change: H983Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098710
Gene: ENSMUSG00000034312
AA Change: H983Q

DomainStartEndE-ValueType
low complexity region 57 68 N/A INTRINSIC
Blast:Sec7 69 369 6e-39 BLAST
low complexity region 370 389 N/A INTRINSIC
low complexity region 396 430 N/A INTRINSIC
low complexity region 450 481 N/A INTRINSIC
Sec7 505 696 1.31e-95 SMART
PH 737 848 2.39e-2 SMART
low complexity region 901 914 N/A INTRINSIC
low complexity region 963 976 N/A INTRINSIC
low complexity region 978 1000 N/A INTRINSIC
low complexity region 1014 1060 N/A INTRINSIC
low complexity region 1062 1094 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101153
SMART Domains Protein: ENSMUSP00000098712
Gene: ENSMUSG00000034312

DomainStartEndE-ValueType
low complexity region 71 82 N/A INTRINSIC
Blast:Sec7 83 383 4e-39 BLAST
low complexity region 384 403 N/A INTRINSIC
low complexity region 410 444 N/A INTRINSIC
low complexity region 464 495 N/A INTRINSIC
Sec7 519 710 1.31e-95 SMART
PH 751 862 2.39e-2 SMART
low complexity region 915 928 N/A INTRINSIC
low complexity region 948 957 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212100
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (58/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in neurons fail to exhibit mGluR- and NMDAR-mediated long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,297,906 V31I probably benign Het
4933430I17Rik T C 4: 62,532,261 V24A possibly damaging Het
Adamtsl3 A T 7: 82,514,978 R334W probably damaging Het
Aox1 G A 1: 58,049,403 C116Y probably damaging Het
B3gntl1 A T 11: 121,670,914 I74N probably damaging Het
Bicra C T 7: 15,988,213 V460M possibly damaging Het
Ccdc18 G A 5: 108,163,739 C437Y possibly damaging Het
Cdh6 A G 15: 13,034,310 S755P probably damaging Het
Crtc2 G T 3: 90,259,212 A165S probably damaging Het
Cwf19l2 C T 9: 3,456,775 H703Y probably damaging Het
Cyc1 C A 15: 76,343,685 T41K probably benign Het
Defb28 A T 2: 152,518,301 H12L possibly damaging Het
Dsg3 T A 18: 20,533,464 C577S probably benign Het
Ggt6 G T 11: 72,437,898 C408F possibly damaging Het
Gm3278 T A 14: 4,893,441 Y97N probably damaging Het
Gpr155 A G 2: 73,368,339 L412P probably damaging Het
Gucd1 T C 10: 75,511,185 H77R probably benign Het
Hat1 T A 2: 71,420,347 I158N probably damaging Het
Hhla1 C T 15: 65,936,382 W271* probably null Het
Hist1h2bg G A 13: 23,571,484 A18T unknown Het
Igsf10 T A 3: 59,319,354 L2299F probably damaging Het
Irx2 G T 13: 72,629,209 G50C probably damaging Het
Kif26b T C 1: 178,529,499 probably benign Het
Lmo7 A G 14: 101,919,609 E1405G unknown Het
Mdm2 T C 10: 117,690,691 D330G possibly damaging Het
Mgat5 A C 1: 127,366,455 D178A probably benign Het
Mier2 C A 10: 79,550,342 R25L probably benign Het
Mlip T C 9: 77,164,803 K257E probably damaging Het
Mtfr2 T C 10: 20,353,385 S80P probably benign Het
Ndst2 A G 14: 20,730,085 V29A probably benign Het
Negr1 T G 3: 157,069,233 Y195* probably null Het
Nptn T C 9: 58,618,873 L101P probably damaging Het
Nrip1 G A 16: 76,294,459 T70I probably damaging Het
Nrtn C T 17: 56,751,633 V123M probably damaging Het
Olfr59 A T 11: 74,289,123 H159L possibly damaging Het
Onecut1 T A 9: 74,863,240 F315Y possibly damaging Het
P4htm A G 9: 108,583,679 L198S probably damaging Het
Pappa A C 4: 65,231,182 I920L probably benign Het
Pcdhgb5 A C 18: 37,732,472 D440A probably damaging Het
Ppard A T 17: 28,298,761 N268Y possibly damaging Het
Rapgef6 T A 11: 54,636,171 S563T probably benign Het
Rtn3 T A 19: 7,429,753 E949D probably benign Het
Sf3a1 T C 11: 4,177,561 M629T probably benign Het
Slc39a8 T C 3: 135,884,306 I319T probably benign Het
Sorcs1 C T 19: 50,182,674 W925* probably null Het
Spag9 G A 11: 94,108,464 D1069N probably damaging Het
Taar7a A G 10: 23,992,994 V163A possibly damaging Het
Tmem150a G A 6: 72,356,770 probably null Het
Tnxb G A 17: 34,715,691 V2425I possibly damaging Het
Tppp2 A G 14: 51,920,601 K168E possibly damaging Het
Ttn T A 2: 76,889,468 D7099V unknown Het
Vmn1r41 A T 6: 89,747,177 R50* probably null Het
Vmn1r60 T C 7: 5,544,862 K80E Het
Vmn2r18 A G 5: 151,585,020 F213S possibly damaging Het
Vmn2r26 G A 6: 124,039,741 S388N probably benign Het
Vmn2r63 A T 7: 42,926,967 F474Y probably damaging Het
Zc3hav1 G A 6: 38,332,940 R316* probably null Het
Zfp654 A T 16: 64,791,848 I225N probably damaging Het
Zfp97 A G 17: 17,145,280 E347G probably damaging Het
Other mutations in Iqsec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Iqsec1 APN 6 90689703 missense probably damaging 1.00
IGL01749:Iqsec1 APN 6 90680504 missense probably benign 0.03
IGL01960:Iqsec1 APN 6 90676780 missense probably damaging 1.00
IGL02007:Iqsec1 APN 6 90690349 missense probably benign 0.37
IGL02045:Iqsec1 APN 6 90664069 missense probably damaging 0.96
IGL02186:Iqsec1 APN 6 90676877 missense probably damaging 1.00
IGL02211:Iqsec1 APN 6 90671609 missense probably damaging 1.00
IGL02503:Iqsec1 APN 6 90668788 missense probably damaging 1.00
IGL02506:Iqsec1 APN 6 90672075 missense possibly damaging 0.94
IGL02554:Iqsec1 APN 6 90669345 missense probably damaging 1.00
PIT4260001:Iqsec1 UTSW 6 90690489 missense probably damaging 1.00
PIT4810001:Iqsec1 UTSW 6 90670491 missense probably damaging 1.00
R0139:Iqsec1 UTSW 6 90809758 intron probably benign
R0371:Iqsec1 UTSW 6 90670403 splice site probably benign
R0617:Iqsec1 UTSW 6 90689970 missense probably damaging 1.00
R0619:Iqsec1 UTSW 6 90670406 splice site probably null
R1157:Iqsec1 UTSW 6 90669384 missense possibly damaging 0.83
R1168:Iqsec1 UTSW 6 90689676 missense probably damaging 1.00
R1190:Iqsec1 UTSW 6 90689677 missense probably damaging 1.00
R1192:Iqsec1 UTSW 6 90671976 splice site probably benign
R1435:Iqsec1 UTSW 6 90672024 missense probably damaging 1.00
R1449:Iqsec1 UTSW 6 90690808 nonsense probably null
R1697:Iqsec1 UTSW 6 90809770 nonsense probably null
R1921:Iqsec1 UTSW 6 90662895 missense probably benign 0.00
R1958:Iqsec1 UTSW 6 90670459 missense probably damaging 1.00
R2017:Iqsec1 UTSW 6 90689930 missense probably benign 0.02
R2082:Iqsec1 UTSW 6 90694574 missense probably damaging 1.00
R2372:Iqsec1 UTSW 6 90694654 missense probably damaging 1.00
R2442:Iqsec1 UTSW 6 90689883 missense possibly damaging 0.52
R4120:Iqsec1 UTSW 6 90662602 nonsense probably null
R4371:Iqsec1 UTSW 6 90694606 missense probably damaging 1.00
R4645:Iqsec1 UTSW 6 90668013 missense probably damaging 1.00
R4864:Iqsec1 UTSW 6 90664056 missense probably damaging 1.00
R5436:Iqsec1 UTSW 6 90845361 intron probably benign
R5790:Iqsec1 UTSW 6 90689880 nonsense probably null
R6007:Iqsec1 UTSW 6 90660987 nonsense probably null
R6143:Iqsec1 UTSW 6 90809684 splice site probably null
R6218:Iqsec1 UTSW 6 90689635 missense probably damaging 1.00
R6972:Iqsec1 UTSW 6 90676768 missense probably damaging 1.00
R7506:Iqsec1 UTSW 6 90667909 missense probably damaging 1.00
R7539:Iqsec1 UTSW 6 90662891 missense probably benign 0.00
R7921:Iqsec1 UTSW 6 90667941 missense probably damaging 1.00
R7946:Iqsec1 UTSW 6 90690270 missense probably damaging 1.00
R8238:Iqsec1 UTSW 6 90689930 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCATGATGATGCGCTGAGTG -3'
(R):5'- AAACTTGGTCTGGCCTGTG -3'

Sequencing Primer
(F):5'- TGAGTGCCCTGCATGACCAG -3'
(R):5'- CTGGCCTGTGTGCTTTGAGATC -3'
Posted On2019-10-17