Incidental Mutation 'R7506:Vmn2r26'
ID 581788
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R7506 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 124024758-124062035 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 124039741 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 388 (S388N)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: S388N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: S388N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (58/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,297,906 V31I probably benign Het
4933430I17Rik T C 4: 62,532,261 V24A possibly damaging Het
Adamtsl3 A T 7: 82,514,978 R334W probably damaging Het
Aox1 G A 1: 58,049,403 C116Y probably damaging Het
B3gntl1 A T 11: 121,670,914 I74N probably damaging Het
Bicra C T 7: 15,988,213 V460M possibly damaging Het
Ccdc18 G A 5: 108,163,739 C437Y possibly damaging Het
Cdh6 A G 15: 13,034,310 S755P probably damaging Het
Crtc2 G T 3: 90,259,212 A165S probably damaging Het
Cwf19l2 C T 9: 3,456,775 H703Y probably damaging Het
Cyc1 C A 15: 76,343,685 T41K probably benign Het
Defb28 A T 2: 152,518,301 H12L possibly damaging Het
Dsg3 T A 18: 20,533,464 C577S probably benign Het
Ggt6 G T 11: 72,437,898 C408F possibly damaging Het
Gm3278 T A 14: 4,893,441 Y97N probably damaging Het
Gpr155 A G 2: 73,368,339 L412P probably damaging Het
Gucd1 T C 10: 75,511,185 H77R probably benign Het
Hat1 T A 2: 71,420,347 I158N probably damaging Het
Hhla1 C T 15: 65,936,382 W271* probably null Het
Hist1h2bg G A 13: 23,571,484 A18T unknown Het
Igsf10 T A 3: 59,319,354 L2299F probably damaging Het
Iqsec1 G T 6: 90,662,806 H983Q possibly damaging Het
Iqsec1 A G 6: 90,667,909 S914P probably damaging Het
Irx2 G T 13: 72,629,209 G50C probably damaging Het
Kif26b T C 1: 178,529,499 probably benign Het
Lmo7 A G 14: 101,919,609 E1405G unknown Het
Mdm2 T C 10: 117,690,691 D330G possibly damaging Het
Mgat5 A C 1: 127,366,455 D178A probably benign Het
Mier2 C A 10: 79,550,342 R25L probably benign Het
Mlip T C 9: 77,164,803 K257E probably damaging Het
Mtfr2 T C 10: 20,353,385 S80P probably benign Het
Ndst2 A G 14: 20,730,085 V29A probably benign Het
Negr1 T G 3: 157,069,233 Y195* probably null Het
Nptn T C 9: 58,618,873 L101P probably damaging Het
Nrip1 G A 16: 76,294,459 T70I probably damaging Het
Nrtn C T 17: 56,751,633 V123M probably damaging Het
Olfr59 A T 11: 74,289,123 H159L possibly damaging Het
Onecut1 T A 9: 74,863,240 F315Y possibly damaging Het
P4htm A G 9: 108,583,679 L198S probably damaging Het
Pappa A C 4: 65,231,182 I920L probably benign Het
Pcdhgb5 A C 18: 37,732,472 D440A probably damaging Het
Ppard A T 17: 28,298,761 N268Y possibly damaging Het
Rapgef6 T A 11: 54,636,171 S563T probably benign Het
Rtn3 T A 19: 7,429,753 E949D probably benign Het
Sf3a1 T C 11: 4,177,561 M629T probably benign Het
Slc39a8 T C 3: 135,884,306 I319T probably benign Het
Sorcs1 C T 19: 50,182,674 W925* probably null Het
Spag9 G A 11: 94,108,464 D1069N probably damaging Het
Taar7a A G 10: 23,992,994 V163A possibly damaging Het
Tmem150a G A 6: 72,356,770 probably null Het
Tnxb G A 17: 34,715,691 V2425I possibly damaging Het
Tppp2 A G 14: 51,920,601 K168E possibly damaging Het
Ttn T A 2: 76,889,468 D7099V unknown Het
Vmn1r41 A T 6: 89,747,177 R50* probably null Het
Vmn1r60 T C 7: 5,544,862 K80E Het
Vmn2r18 A G 5: 151,585,020 F213S possibly damaging Het
Vmn2r63 A T 7: 42,926,967 F474Y probably damaging Het
Zc3hav1 G A 6: 38,332,940 R316* probably null Het
Zfp654 A T 16: 64,791,848 I225N probably damaging Het
Zfp97 A G 17: 17,145,280 E347G probably damaging Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124061607 missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124061756 missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124053874 missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124050673 missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124061625 missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124061818 missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124026141 missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124026132 missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124039795 missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124050819 missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124039899 missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124062033 makesense probably null
R0083:Vmn2r26 UTSW 6 124053981 splice site probably null
R0682:Vmn2r26 UTSW 6 124061170 missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124061644 missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124053913 missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124050708 missense probably benign
R1579:Vmn2r26 UTSW 6 124039747 missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124061472 missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124061410 missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124024771 missense probably benign
R1956:Vmn2r26 UTSW 6 124053887 missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124061185 missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124061237 missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124039749 missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124061350 missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124025979 missense probably benign
R4490:Vmn2r26 UTSW 6 124050738 missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124061191 missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124061416 missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124053965 missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124026111 missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124061873 missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124061326 missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124050717 missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124039449 missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124025966 missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124061674 missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124039871 missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124039560 missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124061485 missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124061389 missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124026080 missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124061691 missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124039098 missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124039782 missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124061296 missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124039768 missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124061989 missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124025955 missense probably damaging 0.97
R7672:Vmn2r26 UTSW 6 124039647 missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124039362 missense probably benign
R7696:Vmn2r26 UTSW 6 124061535 missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124061745 missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124039799 nonsense probably null
R8063:Vmn2r26 UTSW 6 124024955 missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124061928 missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124026036 missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124024918 missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124062024 missense probably benign
R9333:Vmn2r26 UTSW 6 124026050 missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124039374 missense probably benign
R9436:Vmn2r26 UTSW 6 124025867 missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124061178 missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124039489 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TATCACCACATTACCCTTTGAACAG -3'
(R):5'- ATTGCTACCTTCCATGGGAGAG -3'

Sequencing Primer
(F):5'- ACACACTTTGGTGGAGGATTATC -3'
(R):5'- GGAGCCTGGAGTAAACATTTATTG -3'
Posted On 2019-10-17