Incidental Mutation 'R7506:Adamtsl3'
ID581792
Institutional Source Beutler Lab
Gene Symbol Adamtsl3
Ensembl Gene ENSMUSG00000070469
Gene NameADAMTS-like 3
Synonymspunctin-2, 9230119C12Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7506 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location82335694-82614450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82514978 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 334 (R334W)
Ref Sequence ENSEMBL: ENSMUSP00000133637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173287] [ENSMUST00000173828]
Predicted Effect probably damaging
Transcript: ENSMUST00000173287
AA Change: R334W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133637
Gene: ENSMUSG00000070469
AA Change: R334W

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 90 136 6.43e-8 SMART
TSP1 355 414 1.59e-1 SMART
TSP1 433 492 3.72e-4 SMART
TSP1 494 547 4.28e-4 SMART
TSP1 579 638 1.85e-2 SMART
TSP1 660 717 1.75e-2 SMART
TSP1 719 773 3.45e-8 SMART
TSP1 775 833 3.67e-3 SMART
TSP1 836 894 8.99e-2 SMART
IGc2 938 1002 7.59e-4 SMART
IG 1213 1296 4.87e0 SMART
IGc2 1326 1388 1.01e-13 SMART
TSP1 1441 1498 1.95e-2 SMART
TSP1 1500 1559 6.76e-2 SMART
TSP1 1616 1666 3.84e-1 SMART
Pfam:PLAC 1674 1704 2.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173828
SMART Domains Protein: ENSMUSP00000133337
Gene: ENSMUSG00000070469

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Blast:IG 22 79 1e-26 BLAST
SCOP:d1biha4 27 77 2e-5 SMART
IG 283 366 4.87e0 SMART
IGc2 396 458 1.01e-13 SMART
TSP1 511 568 1.95e-2 SMART
TSP1 570 629 6.76e-2 SMART
TSP1 686 736 3.84e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (58/59)
MGI Phenotype Strain: 3605825
Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. (SEE BELOW)
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,297,906 V31I probably benign Het
4933430I17Rik T C 4: 62,532,261 V24A possibly damaging Het
Aox1 G A 1: 58,049,403 C116Y probably damaging Het
B3gntl1 A T 11: 121,670,914 I74N probably damaging Het
Bicra C T 7: 15,988,213 V460M possibly damaging Het
Ccdc18 G A 5: 108,163,739 C437Y possibly damaging Het
Cdh6 A G 15: 13,034,310 S755P probably damaging Het
Crtc2 G T 3: 90,259,212 A165S probably damaging Het
Cwf19l2 C T 9: 3,456,775 H703Y probably damaging Het
Cyc1 C A 15: 76,343,685 T41K probably benign Het
Defb28 A T 2: 152,518,301 H12L possibly damaging Het
Dsg3 T A 18: 20,533,464 C577S probably benign Het
Ggt6 G T 11: 72,437,898 C408F possibly damaging Het
Gm3278 T A 14: 4,893,441 Y97N probably damaging Het
Gpr155 A G 2: 73,368,339 L412P probably damaging Het
Gucd1 T C 10: 75,511,185 H77R probably benign Het
Hat1 T A 2: 71,420,347 I158N probably damaging Het
Hhla1 C T 15: 65,936,382 W271* probably null Het
Hist1h2bg G A 13: 23,571,484 A18T unknown Het
Igsf10 T A 3: 59,319,354 L2299F probably damaging Het
Iqsec1 G T 6: 90,662,806 H983Q possibly damaging Het
Iqsec1 A G 6: 90,667,909 S914P probably damaging Het
Irx2 G T 13: 72,629,209 G50C probably damaging Het
Kif26b T C 1: 178,529,499 probably benign Het
Lmo7 A G 14: 101,919,609 E1405G unknown Het
Mdm2 T C 10: 117,690,691 D330G possibly damaging Het
Mgat5 A C 1: 127,366,455 D178A probably benign Het
Mier2 C A 10: 79,550,342 R25L probably benign Het
Mlip T C 9: 77,164,803 K257E probably damaging Het
Mtfr2 T C 10: 20,353,385 S80P probably benign Het
Ndst2 A G 14: 20,730,085 V29A probably benign Het
Negr1 T G 3: 157,069,233 Y195* probably null Het
Nptn T C 9: 58,618,873 L101P probably damaging Het
Nrip1 G A 16: 76,294,459 T70I probably damaging Het
Nrtn C T 17: 56,751,633 V123M probably damaging Het
Olfr59 A T 11: 74,289,123 H159L possibly damaging Het
Onecut1 T A 9: 74,863,240 F315Y possibly damaging Het
P4htm A G 9: 108,583,679 L198S probably damaging Het
Pappa A C 4: 65,231,182 I920L probably benign Het
Pcdhgb5 A C 18: 37,732,472 D440A probably damaging Het
Ppard A T 17: 28,298,761 N268Y possibly damaging Het
Rapgef6 T A 11: 54,636,171 S563T probably benign Het
Rtn3 T A 19: 7,429,753 E949D probably benign Het
Sf3a1 T C 11: 4,177,561 M629T probably benign Het
Slc39a8 T C 3: 135,884,306 I319T probably benign Het
Sorcs1 C T 19: 50,182,674 W925* probably null Het
Spag9 G A 11: 94,108,464 D1069N probably damaging Het
Taar7a A G 10: 23,992,994 V163A possibly damaging Het
Tmem150a G A 6: 72,356,770 probably null Het
Tnxb G A 17: 34,715,691 V2425I possibly damaging Het
Tppp2 A G 14: 51,920,601 K168E possibly damaging Het
Ttn T A 2: 76,889,468 D7099V unknown Het
Vmn1r41 A T 6: 89,747,177 R50* probably null Het
Vmn1r60 T C 7: 5,544,862 K80E Het
Vmn2r18 A G 5: 151,585,020 F213S possibly damaging Het
Vmn2r26 G A 6: 124,039,741 S388N probably benign Het
Vmn2r63 A T 7: 42,926,967 F474Y probably damaging Het
Zc3hav1 G A 6: 38,332,940 R316* probably null Het
Zfp654 A T 16: 64,791,848 I225N probably damaging Het
Zfp97 A G 17: 17,145,280 E347G probably damaging Het
Other mutations in Adamtsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Adamtsl3 APN 7 82612448 missense probably damaging 1.00
IGL01936:Adamtsl3 APN 7 82595371 missense possibly damaging 0.93
IGL02819:Adamtsl3 APN 7 82574121 missense probably damaging 0.99
P0012:Adamtsl3 UTSW 7 82574257 missense probably benign 0.27
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0180:Adamtsl3 UTSW 7 82575990 missense probably benign 0.00
R0270:Adamtsl3 UTSW 7 82556824 missense probably damaging 1.00
R0295:Adamtsl3 UTSW 7 82548005 critical splice donor site probably null
R0329:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0330:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0548:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R0611:Adamtsl3 UTSW 7 82528912 missense probably damaging 1.00
R0671:Adamtsl3 UTSW 7 82523182 missense probably damaging 1.00
R0711:Adamtsl3 UTSW 7 82465699 intron probably benign
R0845:Adamtsl3 UTSW 7 82575996 missense probably damaging 1.00
R1119:Adamtsl3 UTSW 7 82540317 missense probably damaging 0.96
R1458:Adamtsl3 UTSW 7 82523320 missense probably damaging 1.00
R1644:Adamtsl3 UTSW 7 82450090 missense possibly damaging 0.87
R1691:Adamtsl3 UTSW 7 82499606 missense probably damaging 1.00
R1838:Adamtsl3 UTSW 7 82493373 missense probably damaging 1.00
R2131:Adamtsl3 UTSW 7 82578594 missense probably damaging 1.00
R2245:Adamtsl3 UTSW 7 82450100 missense probably damaging 1.00
R2274:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2275:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2448:Adamtsl3 UTSW 7 82499748 missense probably damaging 1.00
R3725:Adamtsl3 UTSW 7 82612404 missense possibly damaging 0.80
R3757:Adamtsl3 UTSW 7 82337207 missense probably benign 0.01
R3821:Adamtsl3 UTSW 7 82606479 splice site probably benign
R4618:Adamtsl3 UTSW 7 82606520 missense probably benign 0.41
R4842:Adamtsl3 UTSW 7 82528861 missense probably damaging 1.00
R4887:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4888:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4925:Adamtsl3 UTSW 7 82602299 critical splice donor site probably null
R4960:Adamtsl3 UTSW 7 82566977 missense probably damaging 0.99
R5026:Adamtsl3 UTSW 7 82576054 missense probably benign 0.07
R5152:Adamtsl3 UTSW 7 82574544 missense probably benign 0.11
R5198:Adamtsl3 UTSW 7 82611798 missense possibly damaging 0.63
R5244:Adamtsl3 UTSW 7 82598069 missense probably benign 0.02
R5281:Adamtsl3 UTSW 7 82528934 missense probably damaging 1.00
R5323:Adamtsl3 UTSW 7 82557061 missense probably damaging 1.00
R5523:Adamtsl3 UTSW 7 82574442 missense possibly damaging 0.86
R5602:Adamtsl3 UTSW 7 82557239 missense possibly damaging 0.89
R5638:Adamtsl3 UTSW 7 82611750 missense probably damaging 0.99
R5682:Adamtsl3 UTSW 7 82606550 missense probably damaging 0.99
R5782:Adamtsl3 UTSW 7 82540286 intron probably null
R5946:Adamtsl3 UTSW 7 82576057 missense probably damaging 0.98
R6091:Adamtsl3 UTSW 7 82465621 missense probably damaging 1.00
R6258:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R6500:Adamtsl3 UTSW 7 82578610 missense probably benign 0.00
R6765:Adamtsl3 UTSW 7 82567024 missense possibly damaging 0.60
R6785:Adamtsl3 UTSW 7 82522004 missense probably damaging 0.99
R6982:Adamtsl3 UTSW 7 82515063 missense probably damaging 1.00
R7109:Adamtsl3 UTSW 7 82611861 missense
R7341:Adamtsl3 UTSW 7 82556874 missense probably damaging 1.00
R7402:Adamtsl3 UTSW 7 82578617 missense probably damaging 0.96
R7549:Adamtsl3 UTSW 7 82573909 missense probably damaging 1.00
R7575:Adamtsl3 UTSW 7 82574548 missense possibly damaging 0.85
R7592:Adamtsl3 UTSW 7 82337251 missense probably benign 0.00
R7654:Adamtsl3 UTSW 7 82574494 missense probably benign
R7721:Adamtsl3 UTSW 7 82606520 missense possibly damaging 0.62
R7784:Adamtsl3 UTSW 7 82573989 missense probably damaging 1.00
R7858:Adamtsl3 UTSW 7 82450163 missense probably damaging 1.00
R7941:Adamtsl3 UTSW 7 82450163 missense probably damaging 1.00
RF005:Adamtsl3 UTSW 7 82612395 missense
X0003:Adamtsl3 UTSW 7 82611759 nonsense probably null
X0063:Adamtsl3 UTSW 7 82574157 missense probably benign 0.25
Z1088:Adamtsl3 UTSW 7 82499714 missense probably damaging 1.00
Z1088:Adamtsl3 UTSW 7 82540325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGGCAAGTCTGAGTGAC -3'
(R):5'- TATTAAGACCTTGAACTCAGCACAC -3'

Sequencing Primer
(F):5'- GAGTGACAGGCTATCCTATCTAAAGC -3'
(R):5'- GTCTTAAAGTCCATCTCAACCAGGTG -3'
Posted On2019-10-17