Incidental Mutation 'R7506:P4htm'
ID581798
Institutional Source Beutler Lab
Gene Symbol P4htm
Ensembl Gene ENSMUSG00000006675
Gene Nameprolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
SynonymsP4h-tm, 4933406E20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7506 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108578862-108597667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108583679 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 198 (L198S)
Ref Sequence ENSEMBL: ENSMUSP00000006853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006853] [ENSMUST00000068700] [ENSMUST00000193621]
Predicted Effect probably damaging
Transcript: ENSMUST00000006853
AA Change: L198S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006853
Gene: ENSMUSG00000006675
AA Change: L198S

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
P4Hc 143 460 1.26e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068700
SMART Domains Protein: ENSMUSP00000070927
Gene: ENSMUSG00000066357

DomainStartEndE-ValueType
Blast:WD40 109 142 3e-6 BLAST
WD40 198 237 1.42e-4 SMART
WD40 247 284 7.28e-2 SMART
WD40 286 326 1.72e-3 SMART
Blast:WD40 336 375 3e-13 BLAST
WD40 479 519 2.96e1 SMART
low complexity region 537 552 N/A INTRINSIC
WD40 559 598 1.77e2 SMART
Blast:WD40 600 641 7e-20 BLAST
Blast:WD40 764 815 2e-22 BLAST
Blast:WD40 855 896 2e-11 BLAST
WD40 900 949 1.48e1 SMART
WD40 973 1015 5.52e-2 SMART
WD40 1035 1076 3.98e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192080
AA Change: L125S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000193621
AA Change: L198S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141843
Gene: ENSMUSG00000006675
AA Change: L198S

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
Blast:P4Hc 143 211 5e-39 BLAST
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of prolyl 4-hydroxylases. This protein is a prolyl hydroxylase that may be involved in the degradation of hypoxia-inducible transcription factors under normoxia. It plays a role in adaptation to hypoxia and may be related to cellular oxygen sensing. Alternatively spliced variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased body weight, normal erythropoiesis, and cardioprotection after ischemia-reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,297,906 V31I probably benign Het
4933430I17Rik T C 4: 62,532,261 V24A possibly damaging Het
Adamtsl3 A T 7: 82,514,978 R334W probably damaging Het
Aox1 G A 1: 58,049,403 C116Y probably damaging Het
B3gntl1 A T 11: 121,670,914 I74N probably damaging Het
Bicra C T 7: 15,988,213 V460M possibly damaging Het
Ccdc18 G A 5: 108,163,739 C437Y possibly damaging Het
Cdh6 A G 15: 13,034,310 S755P probably damaging Het
Crtc2 G T 3: 90,259,212 A165S probably damaging Het
Cwf19l2 C T 9: 3,456,775 H703Y probably damaging Het
Cyc1 C A 15: 76,343,685 T41K probably benign Het
Defb28 A T 2: 152,518,301 H12L possibly damaging Het
Dsg3 T A 18: 20,533,464 C577S probably benign Het
Ggt6 G T 11: 72,437,898 C408F possibly damaging Het
Gm3278 T A 14: 4,893,441 Y97N probably damaging Het
Gpr155 A G 2: 73,368,339 L412P probably damaging Het
Gucd1 T C 10: 75,511,185 H77R probably benign Het
Hat1 T A 2: 71,420,347 I158N probably damaging Het
Hhla1 C T 15: 65,936,382 W271* probably null Het
Hist1h2bg G A 13: 23,571,484 A18T unknown Het
Igsf10 T A 3: 59,319,354 L2299F probably damaging Het
Iqsec1 G T 6: 90,662,806 H983Q possibly damaging Het
Iqsec1 A G 6: 90,667,909 S914P probably damaging Het
Irx2 G T 13: 72,629,209 G50C probably damaging Het
Kif26b T C 1: 178,529,499 probably benign Het
Lmo7 A G 14: 101,919,609 E1405G unknown Het
Mdm2 T C 10: 117,690,691 D330G possibly damaging Het
Mgat5 A C 1: 127,366,455 D178A probably benign Het
Mier2 C A 10: 79,550,342 R25L probably benign Het
Mlip T C 9: 77,164,803 K257E probably damaging Het
Mtfr2 T C 10: 20,353,385 S80P probably benign Het
Ndst2 A G 14: 20,730,085 V29A probably benign Het
Negr1 T G 3: 157,069,233 Y195* probably null Het
Nptn T C 9: 58,618,873 L101P probably damaging Het
Nrip1 G A 16: 76,294,459 T70I probably damaging Het
Nrtn C T 17: 56,751,633 V123M probably damaging Het
Olfr59 A T 11: 74,289,123 H159L possibly damaging Het
Onecut1 T A 9: 74,863,240 F315Y possibly damaging Het
Pappa A C 4: 65,231,182 I920L probably benign Het
Pcdhgb5 A C 18: 37,732,472 D440A probably damaging Het
Ppard A T 17: 28,298,761 N268Y possibly damaging Het
Rapgef6 T A 11: 54,636,171 S563T probably benign Het
Rtn3 T A 19: 7,429,753 E949D probably benign Het
Sf3a1 T C 11: 4,177,561 M629T probably benign Het
Slc39a8 T C 3: 135,884,306 I319T probably benign Het
Sorcs1 C T 19: 50,182,674 W925* probably null Het
Spag9 G A 11: 94,108,464 D1069N probably damaging Het
Taar7a A G 10: 23,992,994 V163A possibly damaging Het
Tmem150a G A 6: 72,356,770 probably null Het
Tnxb G A 17: 34,715,691 V2425I possibly damaging Het
Tppp2 A G 14: 51,920,601 K168E possibly damaging Het
Ttn T A 2: 76,889,468 D7099V unknown Het
Vmn1r41 A T 6: 89,747,177 R50* probably null Het
Vmn1r60 T C 7: 5,544,862 K80E Het
Vmn2r18 A G 5: 151,585,020 F213S possibly damaging Het
Vmn2r26 G A 6: 124,039,741 S388N probably benign Het
Vmn2r63 A T 7: 42,926,967 F474Y probably damaging Het
Zc3hav1 G A 6: 38,332,940 R316* probably null Het
Zfp654 A T 16: 64,791,848 I225N probably damaging Het
Zfp97 A G 17: 17,145,280 E347G probably damaging Het
Other mutations in P4htm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:P4htm APN 9 108583736 missense probably damaging 1.00
IGL02205:P4htm APN 9 108581962 missense probably benign 0.08
IGL02756:P4htm APN 9 108579778 missense probably damaging 1.00
IGL02802:P4htm UTSW 9 108582856 missense probably benign 0.00
R0605:P4htm UTSW 9 108583724 missense probably null 0.17
R3922:P4htm UTSW 9 108582895 missense probably benign
R4562:P4htm UTSW 9 108581996 missense probably null 1.00
R4730:P4htm UTSW 9 108579772 missense possibly damaging 0.89
R4900:P4htm UTSW 9 108579228 missense probably damaging 1.00
R5027:P4htm UTSW 9 108579293 missense probably benign 0.16
R5124:P4htm UTSW 9 108581942 missense possibly damaging 0.59
R5633:P4htm UTSW 9 108579723 missense probably damaging 1.00
R5877:P4htm UTSW 9 108583733 missense possibly damaging 0.94
R5927:P4htm UTSW 9 108597383 missense probably damaging 1.00
R6163:P4htm UTSW 9 108581951 missense probably damaging 0.99
R6798:P4htm UTSW 9 108582918 missense possibly damaging 0.83
R6920:P4htm UTSW 9 108583613 missense probably benign 0.01
R6962:P4htm UTSW 9 108579195 missense possibly damaging 0.49
R7066:P4htm UTSW 9 108596963 missense probably damaging 0.98
R7183:P4htm UTSW 9 108581860 missense possibly damaging 0.95
R7376:P4htm UTSW 9 108580792 missense probably damaging 0.98
R7533:P4htm UTSW 9 108596937 missense probably benign 0.02
R7874:P4htm UTSW 9 108596949 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTTCCTCTGGAGTCTCTGG -3'
(R):5'- TCCAGCTCAGTCATCAGCATC -3'

Sequencing Primer
(F):5'- TCTCTGGGGCAGTAAGGGAC -3'
(R):5'- TCAGTCATCAGCATCACCCAC -3'
Posted On2019-10-17