Incidental Mutation 'R7506:Mdm2'
ID581803
Institutional Source Beutler Lab
Gene Symbol Mdm2
Ensembl Gene ENSMUSG00000020184
Gene Nametransformed mouse 3T3 cell double minute 2
SynonymsMdm-2, 1700007J15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7506 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location117688875-117710758 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117690691 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 330 (D330G)
Ref Sequence ENSEMBL: ENSMUSP00000020408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020399] [ENSMUST00000020408] [ENSMUST00000105263] [ENSMUST00000155285]
Predicted Effect probably benign
Transcript: ENSMUST00000020399
SMART Domains Protein: ENSMUSP00000020399
Gene: ENSMUSG00000020183

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Zn_pept 22 406 2.03e-45 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000020408
AA Change: D330G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020408
Gene: ENSMUSG00000020184
AA Change: D330G

DomainStartEndE-ValueType
Pfam:SWIB 26 101 1.3e-11 PFAM
low complexity region 145 166 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
Pfam:zf-RanBP 297 326 1.7e-10 PFAM
low complexity region 390 410 N/A INTRINSIC
RING 436 476 2.42e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105263
AA Change: D281G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100898
Gene: ENSMUSG00000020184
AA Change: D281G

DomainStartEndE-ValueType
Pfam:SWIB 1 53 5e-15 PFAM
low complexity region 96 117 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
low complexity region 199 213 N/A INTRINSIC
Pfam:zf-RanBP 248 277 5.7e-10 PFAM
low complexity region 341 361 N/A INTRINSIC
RING 387 427 2.42e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155285
SMART Domains Protein: ENSMUSP00000137039
Gene: ENSMUSG00000020184

DomainStartEndE-ValueType
Pfam:SWIB 27 102 3.1e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear-localized E3 ubiquitin ligase. The encoded protein can promote tumor formation by targeting tumor suppressor proteins, such as p53, for proteasomal degradation. This gene is itself transcriptionally-regulated by p53. Overexpression or amplification of this locus is detected in a variety of different cancers. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in a multitude of transcript variants, many of which may be expressed only in tumor cells. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality. Mice homozygous for a null allele exhibit prenatal lethality. Mice homozygous for one knock-in allele exhibit embryonic lethality while mice homozygous for a different knock-in allele exhibit alters cell cycle regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,297,906 V31I probably benign Het
4933430I17Rik T C 4: 62,532,261 V24A possibly damaging Het
Adamtsl3 A T 7: 82,514,978 R334W probably damaging Het
Aox1 G A 1: 58,049,403 C116Y probably damaging Het
B3gntl1 A T 11: 121,670,914 I74N probably damaging Het
Bicra C T 7: 15,988,213 V460M possibly damaging Het
Ccdc18 G A 5: 108,163,739 C437Y possibly damaging Het
Cdh6 A G 15: 13,034,310 S755P probably damaging Het
Crtc2 G T 3: 90,259,212 A165S probably damaging Het
Cwf19l2 C T 9: 3,456,775 H703Y probably damaging Het
Cyc1 C A 15: 76,343,685 T41K probably benign Het
Defb28 A T 2: 152,518,301 H12L possibly damaging Het
Dsg3 T A 18: 20,533,464 C577S probably benign Het
Ggt6 G T 11: 72,437,898 C408F possibly damaging Het
Gm3278 T A 14: 4,893,441 Y97N probably damaging Het
Gpr155 A G 2: 73,368,339 L412P probably damaging Het
Gucd1 T C 10: 75,511,185 H77R probably benign Het
Hat1 T A 2: 71,420,347 I158N probably damaging Het
Hhla1 C T 15: 65,936,382 W271* probably null Het
Hist1h2bg G A 13: 23,571,484 A18T unknown Het
Igsf10 T A 3: 59,319,354 L2299F probably damaging Het
Iqsec1 G T 6: 90,662,806 H983Q possibly damaging Het
Iqsec1 A G 6: 90,667,909 S914P probably damaging Het
Irx2 G T 13: 72,629,209 G50C probably damaging Het
Kif26b T C 1: 178,529,499 probably benign Het
Lmo7 A G 14: 101,919,609 E1405G unknown Het
Mgat5 A C 1: 127,366,455 D178A probably benign Het
Mier2 C A 10: 79,550,342 R25L probably benign Het
Mlip T C 9: 77,164,803 K257E probably damaging Het
Mtfr2 T C 10: 20,353,385 S80P probably benign Het
Ndst2 A G 14: 20,730,085 V29A probably benign Het
Negr1 T G 3: 157,069,233 Y195* probably null Het
Nptn T C 9: 58,618,873 L101P probably damaging Het
Nrip1 G A 16: 76,294,459 T70I probably damaging Het
Nrtn C T 17: 56,751,633 V123M probably damaging Het
Olfr59 A T 11: 74,289,123 H159L possibly damaging Het
Onecut1 T A 9: 74,863,240 F315Y possibly damaging Het
P4htm A G 9: 108,583,679 L198S probably damaging Het
Pappa A C 4: 65,231,182 I920L probably benign Het
Pcdhgb5 A C 18: 37,732,472 D440A probably damaging Het
Ppard A T 17: 28,298,761 N268Y possibly damaging Het
Rapgef6 T A 11: 54,636,171 S563T probably benign Het
Rtn3 T A 19: 7,429,753 E949D probably benign Het
Sf3a1 T C 11: 4,177,561 M629T probably benign Het
Slc39a8 T C 3: 135,884,306 I319T probably benign Het
Sorcs1 C T 19: 50,182,674 W925* probably null Het
Spag9 G A 11: 94,108,464 D1069N probably damaging Het
Taar7a A G 10: 23,992,994 V163A possibly damaging Het
Tmem150a G A 6: 72,356,770 probably null Het
Tnxb G A 17: 34,715,691 V2425I possibly damaging Het
Tppp2 A G 14: 51,920,601 K168E possibly damaging Het
Ttn T A 2: 76,889,468 D7099V unknown Het
Vmn1r41 A T 6: 89,747,177 R50* probably null Het
Vmn1r60 T C 7: 5,544,862 K80E Het
Vmn2r18 A G 5: 151,585,020 F213S possibly damaging Het
Vmn2r26 G A 6: 124,039,741 S388N probably benign Het
Vmn2r63 A T 7: 42,926,967 F474Y probably damaging Het
Zc3hav1 G A 6: 38,332,940 R316* probably null Het
Zfp654 A T 16: 64,791,848 I225N probably damaging Het
Zfp97 A G 17: 17,145,280 E347G probably damaging Het
Other mutations in Mdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Mdm2 APN 10 117702299 missense possibly damaging 0.91
IGL02102:Mdm2 APN 10 117692717 missense possibly damaging 0.93
Xi-an UTSW 10 117709789 splice site probably null
PIT1430001:Mdm2 UTSW 10 117694935 missense probably damaging 1.00
R0322:Mdm2 UTSW 10 117702204 missense possibly damaging 0.78
R1589:Mdm2 UTSW 10 117690529 missense probably benign 0.01
R1766:Mdm2 UTSW 10 117696022 missense probably damaging 1.00
R3153:Mdm2 UTSW 10 117709713 missense possibly damaging 0.90
R4384:Mdm2 UTSW 10 117696439 missense possibly damaging 0.67
R4411:Mdm2 UTSW 10 117709789 splice site probably null
R5111:Mdm2 UTSW 10 117691221 missense possibly damaging 0.94
R5509:Mdm2 UTSW 10 117690612 missense probably damaging 1.00
R5578:Mdm2 UTSW 10 117702287 missense possibly damaging 0.81
R5727:Mdm2 UTSW 10 117702307 missense possibly damaging 0.77
R6382:Mdm2 UTSW 10 117692721 missense probably benign 0.31
R8363:Mdm2 UTSW 10 117690334 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAAACAATGCTGCTGGAAGTCG -3'
(R):5'- GCTACATGGTATACTTTTACCTTAGCC -3'

Sequencing Primer
(F):5'- GAATAGTCGTCACTCTCCTGGGAC -3'
(R):5'- GCCACATTGAAGTTATTAGCCTTGC -3'
Posted On2019-10-17