Incidental Mutation 'R7506:Ggt6'
ID581806
Institutional Source Beutler Lab
Gene Symbol Ggt6
Ensembl Gene ENSMUSG00000040471
Gene Namegamma-glutamyltransferase 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7506 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location72435526-72438400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 72437898 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 408 (C408F)
Ref Sequence ENSEMBL: ENSMUSP00000075773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045633] [ENSMUST00000076443] [ENSMUST00000100903] [ENSMUST00000108499]
Predicted Effect probably benign
Transcript: ENSMUST00000045633
SMART Domains Protein: ENSMUSP00000044827
Gene: ENSMUSG00000040463

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:DNA_pol_phi 70 835 1.2e-194 PFAM
low complexity region 839 852 N/A INTRINSIC
low complexity region 1080 1090 N/A INTRINSIC
low complexity region 1109 1122 N/A INTRINSIC
low complexity region 1259 1269 N/A INTRINSIC
low complexity region 1314 1329 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000076443
AA Change: C408F

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000075773
Gene: ENSMUSG00000040471
AA Change: C408F

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 53 77 N/A INTRINSIC
Pfam:G_glu_transpept 124 179 1.4e-9 PFAM
Pfam:G_glu_transpept 180 276 7.6e-11 PFAM
Pfam:G_glu_transpept 327 402 1.4e-9 PFAM
low complexity region 449 460 N/A INTRINSIC
low complexity region 475 489 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100903
AA Change: C370F

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098463
Gene: ENSMUSG00000040471
AA Change: C370F

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
low complexity region 53 77 N/A INTRINSIC
Pfam:G_glu_transpept 125 238 2.1e-11 PFAM
Pfam:G_glu_transpept 290 367 6.7e-9 PFAM
low complexity region 411 422 N/A INTRINSIC
low complexity region 437 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108499
SMART Domains Protein: ENSMUSP00000104139
Gene: ENSMUSG00000040471

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
Meta Mutation Damage Score 0.5424 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GGT6 belongs to the gamma-glutamyltransferase (GGT; EC 2.3.2.2) gene family. GGT is a membrane-bound extracellular enzyme that cleaves gamma-glutamyl peptide bonds in glutathione and other peptides and transfers the gamma-glutamyl moiety to acceptors. GGT is also key to glutathione homeostasis because it provides substrates for glutathione synthesis (Heisterkamp et al., 2008 [PubMed 18357469]).[supplied by OMIM, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,297,906 V31I probably benign Het
4933430I17Rik T C 4: 62,532,261 V24A possibly damaging Het
Adamtsl3 A T 7: 82,514,978 R334W probably damaging Het
Aox1 G A 1: 58,049,403 C116Y probably damaging Het
B3gntl1 A T 11: 121,670,914 I74N probably damaging Het
Bicra C T 7: 15,988,213 V460M possibly damaging Het
Ccdc18 G A 5: 108,163,739 C437Y possibly damaging Het
Cdh6 A G 15: 13,034,310 S755P probably damaging Het
Crtc2 G T 3: 90,259,212 A165S probably damaging Het
Cwf19l2 C T 9: 3,456,775 H703Y probably damaging Het
Cyc1 C A 15: 76,343,685 T41K probably benign Het
Defb28 A T 2: 152,518,301 H12L possibly damaging Het
Dsg3 T A 18: 20,533,464 C577S probably benign Het
Gm3278 T A 14: 4,893,441 Y97N probably damaging Het
Gpr155 A G 2: 73,368,339 L412P probably damaging Het
Gucd1 T C 10: 75,511,185 H77R probably benign Het
Hat1 T A 2: 71,420,347 I158N probably damaging Het
Hhla1 C T 15: 65,936,382 W271* probably null Het
Hist1h2bg G A 13: 23,571,484 A18T unknown Het
Igsf10 T A 3: 59,319,354 L2299F probably damaging Het
Iqsec1 G T 6: 90,662,806 H983Q possibly damaging Het
Iqsec1 A G 6: 90,667,909 S914P probably damaging Het
Irx2 G T 13: 72,629,209 G50C probably damaging Het
Kif26b T C 1: 178,529,499 probably benign Het
Lmo7 A G 14: 101,919,609 E1405G unknown Het
Mdm2 T C 10: 117,690,691 D330G possibly damaging Het
Mgat5 A C 1: 127,366,455 D178A probably benign Het
Mier2 C A 10: 79,550,342 R25L probably benign Het
Mlip T C 9: 77,164,803 K257E probably damaging Het
Mtfr2 T C 10: 20,353,385 S80P probably benign Het
Ndst2 A G 14: 20,730,085 V29A probably benign Het
Negr1 T G 3: 157,069,233 Y195* probably null Het
Nptn T C 9: 58,618,873 L101P probably damaging Het
Nrip1 G A 16: 76,294,459 T70I probably damaging Het
Nrtn C T 17: 56,751,633 V123M probably damaging Het
Olfr59 A T 11: 74,289,123 H159L possibly damaging Het
Onecut1 T A 9: 74,863,240 F315Y possibly damaging Het
P4htm A G 9: 108,583,679 L198S probably damaging Het
Pappa A C 4: 65,231,182 I920L probably benign Het
Pcdhgb5 A C 18: 37,732,472 D440A probably damaging Het
Ppard A T 17: 28,298,761 N268Y possibly damaging Het
Rapgef6 T A 11: 54,636,171 S563T probably benign Het
Rtn3 T A 19: 7,429,753 E949D probably benign Het
Sf3a1 T C 11: 4,177,561 M629T probably benign Het
Slc39a8 T C 3: 135,884,306 I319T probably benign Het
Sorcs1 C T 19: 50,182,674 W925* probably null Het
Spag9 G A 11: 94,108,464 D1069N probably damaging Het
Taar7a A G 10: 23,992,994 V163A possibly damaging Het
Tmem150a G A 6: 72,356,770 probably null Het
Tnxb G A 17: 34,715,691 V2425I possibly damaging Het
Tppp2 A G 14: 51,920,601 K168E possibly damaging Het
Ttn T A 2: 76,889,468 D7099V unknown Het
Vmn1r41 A T 6: 89,747,177 R50* probably null Het
Vmn1r60 T C 7: 5,544,862 K80E Het
Vmn2r18 A G 5: 151,585,020 F213S possibly damaging Het
Vmn2r26 G A 6: 124,039,741 S388N probably benign Het
Vmn2r63 A T 7: 42,926,967 F474Y probably damaging Het
Zc3hav1 G A 6: 38,332,940 R316* probably null Het
Zfp654 A T 16: 64,791,848 I225N probably damaging Het
Zfp97 A G 17: 17,145,280 E347G probably damaging Het
Other mutations in Ggt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Ggt6 APN 11 72436806 missense possibly damaging 0.51
hallo UTSW 11 72437667 missense probably damaging 0.98
IGL03097:Ggt6 UTSW 11 72436813 missense possibly damaging 0.71
R0080:Ggt6 UTSW 11 72437195 missense possibly damaging 0.92
R0178:Ggt6 UTSW 11 72436818 missense possibly damaging 0.71
R0595:Ggt6 UTSW 11 72437667 missense probably damaging 0.98
R0842:Ggt6 UTSW 11 72437262 nonsense probably null
R1131:Ggt6 UTSW 11 72435680 missense possibly damaging 0.82
R1606:Ggt6 UTSW 11 72437733 missense possibly damaging 0.92
R2029:Ggt6 UTSW 11 72437541 missense possibly damaging 0.90
R2359:Ggt6 UTSW 11 72437551 missense possibly damaging 0.92
R2869:Ggt6 UTSW 11 72437361 missense probably benign 0.00
R2869:Ggt6 UTSW 11 72437361 missense probably benign 0.00
R4462:Ggt6 UTSW 11 72437828 missense possibly damaging 0.52
R4608:Ggt6 UTSW 11 72437943 missense probably benign 0.04
R4735:Ggt6 UTSW 11 72436599 missense probably benign
R5431:Ggt6 UTSW 11 72437738 missense possibly damaging 0.71
R5648:Ggt6 UTSW 11 72435716 missense possibly damaging 0.46
R6390:Ggt6 UTSW 11 72436611 missense possibly damaging 0.86
R6717:Ggt6 UTSW 11 72437520 nonsense probably null
R7798:Ggt6 UTSW 11 72435541 start gained probably benign
Z1177:Ggt6 UTSW 11 72436599 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCCTGCAAACTGCTGAAAC -3'
(R):5'- GCGTGTTCTGCATGGACTAC -3'

Sequencing Primer
(F):5'- CTGAAACCCCAGTGAGCAGTG -3'
(R):5'- TTGGCCACATATGCCAGG -3'
Posted On2019-10-17