Incidental Mutation 'R7506:Lmo7'
ID581815
Institutional Source Beutler Lab
Gene Symbol Lmo7
Ensembl Gene ENSMUSG00000033060
Gene NameLIM domain only 7
SynonymsFBXO20, LOC380928
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R7506 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location101729957-101934710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101919609 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1405 (E1405G)
Ref Sequence ENSEMBL: ENSMUSP00000097910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100337] [ENSMUST00000159258] [ENSMUST00000159314] [ENSMUST00000159597]
Predicted Effect unknown
Transcript: ENSMUST00000100337
AA Change: E1405G
SMART Domains Protein: ENSMUSP00000097910
Gene: ENSMUSG00000033060
AA Change: E1405G

DomainStartEndE-ValueType
CH 14 124 2.57e-13 SMART
low complexity region 200 211 N/A INTRINSIC
Pfam:DUF4757 242 348 2.2e-14 PFAM
low complexity region 448 462 N/A INTRINSIC
Pfam:DUF4757 568 735 1.8e-46 PFAM
low complexity region 861 879 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 1003 1015 N/A INTRINSIC
PDZ 1047 1119 1.05e-8 SMART
coiled coil region 1222 1275 N/A INTRINSIC
coiled coil region 1319 1411 N/A INTRINSIC
low complexity region 1585 1596 N/A INTRINSIC
low complexity region 1599 1617 N/A INTRINSIC
LIM 1629 1687 6.54e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159258
SMART Domains Protein: ENSMUSP00000125465
Gene: ENSMUSG00000033060

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000159314
AA Change: E1172G
SMART Domains Protein: ENSMUSP00000124349
Gene: ENSMUSG00000033060
AA Change: E1172G

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
coiled coil region 435 492 N/A INTRINSIC
low complexity region 628 646 N/A INTRINSIC
low complexity region 746 758 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
PDZ 814 886 1.05e-8 SMART
coiled coil region 989 1042 N/A INTRINSIC
coiled coil region 1086 1178 N/A INTRINSIC
low complexity region 1352 1363 N/A INTRINSIC
low complexity region 1366 1384 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000159597
AA Change: E1310G
SMART Domains Protein: ENSMUSP00000123706
Gene: ENSMUSG00000033060
AA Change: E1310G

DomainStartEndE-ValueType
low complexity region 78 89 N/A INTRINSIC
internal_repeat_1 111 141 6.96e-5 PROSPERO
internal_repeat_1 218 248 6.96e-5 PROSPERO
low complexity region 326 340 N/A INTRINSIC
coiled coil region 546 603 N/A INTRINSIC
low complexity region 739 757 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 881 893 N/A INTRINSIC
PDZ 925 997 1.05e-8 SMART
coiled coil region 1127 1180 N/A INTRINSIC
coiled coil region 1224 1316 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1504 1522 N/A INTRINSIC
LIM 1534 1592 6.54e-10 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000124300
Gene: ENSMUSG00000033060
AA Change: E894G

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
Pfam:DUF4757 76 225 4.5e-53 PFAM
low complexity region 351 369 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
PDZ 537 609 1.05e-8 SMART
internal_repeat_1 620 691 9.31e-5 PROSPERO
coiled coil region 711 764 N/A INTRINSIC
coiled coil region 808 900 N/A INTRINSIC
internal_repeat_1 921 976 9.31e-5 PROSPERO
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1089 1107 N/A INTRINSIC
LIM 1119 1177 6.54e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a calponin homology (CH) domain, a PDZ domain, and a LIM domain, and may be involved in protein-protein interactions. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene, however, the full-length nature of some variants is not known. [provided by RefSeq, Jan 2009]
PHENOTYPE: Targeted mutations in this gene result in postnatal lethality, growth defects, skeletal muscle abnormalities and retinal defects reflective of retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,297,906 V31I probably benign Het
4933430I17Rik T C 4: 62,532,261 V24A possibly damaging Het
Adamtsl3 A T 7: 82,514,978 R334W probably damaging Het
Aox1 G A 1: 58,049,403 C116Y probably damaging Het
B3gntl1 A T 11: 121,670,914 I74N probably damaging Het
Bicra C T 7: 15,988,213 V460M possibly damaging Het
Ccdc18 G A 5: 108,163,739 C437Y possibly damaging Het
Cdh6 A G 15: 13,034,310 S755P probably damaging Het
Crtc2 G T 3: 90,259,212 A165S probably damaging Het
Cwf19l2 C T 9: 3,456,775 H703Y probably damaging Het
Cyc1 C A 15: 76,343,685 T41K probably benign Het
Defb28 A T 2: 152,518,301 H12L possibly damaging Het
Dsg3 T A 18: 20,533,464 C577S probably benign Het
Ggt6 G T 11: 72,437,898 C408F possibly damaging Het
Gm3278 T A 14: 4,893,441 Y97N probably damaging Het
Gpr155 A G 2: 73,368,339 L412P probably damaging Het
Gucd1 T C 10: 75,511,185 H77R probably benign Het
Hat1 T A 2: 71,420,347 I158N probably damaging Het
Hhla1 C T 15: 65,936,382 W271* probably null Het
Hist1h2bg G A 13: 23,571,484 A18T unknown Het
Igsf10 T A 3: 59,319,354 L2299F probably damaging Het
Iqsec1 G T 6: 90,662,806 H983Q possibly damaging Het
Iqsec1 A G 6: 90,667,909 S914P probably damaging Het
Irx2 G T 13: 72,629,209 G50C probably damaging Het
Kif26b T C 1: 178,529,499 probably benign Het
Mdm2 T C 10: 117,690,691 D330G possibly damaging Het
Mgat5 A C 1: 127,366,455 D178A probably benign Het
Mier2 C A 10: 79,550,342 R25L probably benign Het
Mlip T C 9: 77,164,803 K257E probably damaging Het
Mtfr2 T C 10: 20,353,385 S80P probably benign Het
Ndst2 A G 14: 20,730,085 V29A probably benign Het
Negr1 T G 3: 157,069,233 Y195* probably null Het
Nptn T C 9: 58,618,873 L101P probably damaging Het
Nrip1 G A 16: 76,294,459 T70I probably damaging Het
Nrtn C T 17: 56,751,633 V123M probably damaging Het
Olfr59 A T 11: 74,289,123 H159L possibly damaging Het
Onecut1 T A 9: 74,863,240 F315Y possibly damaging Het
P4htm A G 9: 108,583,679 L198S probably damaging Het
Pappa A C 4: 65,231,182 I920L probably benign Het
Pcdhgb5 A C 18: 37,732,472 D440A probably damaging Het
Ppard A T 17: 28,298,761 N268Y possibly damaging Het
Rapgef6 T A 11: 54,636,171 S563T probably benign Het
Rtn3 T A 19: 7,429,753 E949D probably benign Het
Sf3a1 T C 11: 4,177,561 M629T probably benign Het
Slc39a8 T C 3: 135,884,306 I319T probably benign Het
Sorcs1 C T 19: 50,182,674 W925* probably null Het
Spag9 G A 11: 94,108,464 D1069N probably damaging Het
Taar7a A G 10: 23,992,994 V163A possibly damaging Het
Tmem150a G A 6: 72,356,770 probably null Het
Tnxb G A 17: 34,715,691 V2425I possibly damaging Het
Tppp2 A G 14: 51,920,601 K168E possibly damaging Het
Ttn T A 2: 76,889,468 D7099V unknown Het
Vmn1r41 A T 6: 89,747,177 R50* probably null Het
Vmn1r60 T C 7: 5,544,862 K80E Het
Vmn2r18 A G 5: 151,585,020 F213S possibly damaging Het
Vmn2r26 G A 6: 124,039,741 S388N probably benign Het
Vmn2r63 A T 7: 42,926,967 F474Y probably damaging Het
Zc3hav1 G A 6: 38,332,940 R316* probably null Het
Zfp654 A T 16: 64,791,848 I225N probably damaging Het
Zfp97 A G 17: 17,145,280 E347G probably damaging Het
Other mutations in Lmo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Lmo7 APN 14 101887051 missense probably damaging 0.99
IGL00733:Lmo7 APN 14 101915702 missense probably damaging 1.00
IGL00778:Lmo7 APN 14 101910885 splice site probably benign
IGL01014:Lmo7 APN 14 101920557 splice site probably benign
IGL01401:Lmo7 APN 14 101794277 nonsense probably null
IGL01550:Lmo7 APN 14 101926140 utr 3 prime probably benign
IGL01570:Lmo7 APN 14 101902371 critical splice donor site probably null
IGL01602:Lmo7 APN 14 101910756 splice site probably benign
IGL01605:Lmo7 APN 14 101910756 splice site probably benign
IGL02012:Lmo7 APN 14 101888716 intron probably benign
IGL02145:Lmo7 APN 14 101902223 missense probably benign 0.00
IGL02236:Lmo7 APN 14 101926088 splice site probably benign
IGL02318:Lmo7 APN 14 101900066 splice site probably benign
IGL02345:Lmo7 APN 14 101887473 missense probably damaging 1.00
IGL02498:Lmo7 APN 14 101807482 missense probably benign 0.01
IGL02583:Lmo7 APN 14 101933924 utr 3 prime probably benign
IGL02670:Lmo7 APN 14 101880980 missense probably damaging 1.00
IGL02694:Lmo7 APN 14 101887170 missense probably damaging 1.00
IGL03026:Lmo7 APN 14 101929333 utr 3 prime probably benign
IGL03062:Lmo7 APN 14 101912079 missense possibly damaging 0.66
IGL03068:Lmo7 APN 14 101875492 unclassified probably benign
IGL03178:Lmo7 APN 14 101929260 nonsense probably null
IGL03279:Lmo7 APN 14 101900508 missense probably benign 0.30
PIT4458001:Lmo7 UTSW 14 101887487 nonsense probably null
R0029:Lmo7 UTSW 14 101933921 utr 3 prime probably benign
R0112:Lmo7 UTSW 14 101887193 nonsense probably null
R0345:Lmo7 UTSW 14 101876877 missense probably damaging 1.00
R0372:Lmo7 UTSW 14 101918053 splice site probably benign
R0393:Lmo7 UTSW 14 101900456 missense probably benign
R0514:Lmo7 UTSW 14 101887173 missense probably damaging 1.00
R0514:Lmo7 UTSW 14 101896559 missense probably damaging 1.00
R0526:Lmo7 UTSW 14 101900560 missense probably damaging 1.00
R0615:Lmo7 UTSW 14 101876859 nonsense probably null
R0900:Lmo7 UTSW 14 101887188 missense probably damaging 1.00
R0961:Lmo7 UTSW 14 101794269 missense probably benign 0.00
R0964:Lmo7 UTSW 14 101920567 splice site probably benign
R1078:Lmo7 UTSW 14 101920474 splice site probably benign
R1252:Lmo7 UTSW 14 101900583 missense probably damaging 1.00
R1527:Lmo7 UTSW 14 101876828 missense probably damaging 1.00
R1537:Lmo7 UTSW 14 101929264 utr 3 prime probably benign
R1565:Lmo7 UTSW 14 101887521 missense probably damaging 0.99
R1637:Lmo7 UTSW 14 101880832 missense probably damaging 1.00
R1943:Lmo7 UTSW 14 101902302 missense probably damaging 1.00
R1967:Lmo7 UTSW 14 101900215 missense probably benign 0.36
R2002:Lmo7 UTSW 14 101887061 missense probably benign 0.13
R2057:Lmo7 UTSW 14 101887178 missense probably damaging 1.00
R2131:Lmo7 UTSW 14 101900238 missense probably damaging 0.99
R2153:Lmo7 UTSW 14 101920515 utr 3 prime probably benign
R2257:Lmo7 UTSW 14 101900130 missense probably damaging 1.00
R2355:Lmo7 UTSW 14 101888685 missense probably damaging 1.00
R2356:Lmo7 UTSW 14 101886945 missense probably damaging 1.00
R2898:Lmo7 UTSW 14 101876914 missense possibly damaging 0.93
R3847:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3848:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3849:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3916:Lmo7 UTSW 14 101929342 utr 3 prime probably benign
R4050:Lmo7 UTSW 14 101902277 nonsense probably null
R4326:Lmo7 UTSW 14 101900074 missense possibly damaging 0.93
R4357:Lmo7 UTSW 14 101887655 missense probably null 1.00
R4571:Lmo7 UTSW 14 101887594 missense probably damaging 0.96
R4658:Lmo7 UTSW 14 101886957 missense probably damaging 1.00
R4857:Lmo7 UTSW 14 101887348 intron probably null
R5006:Lmo7 UTSW 14 101926237 utr 3 prime probably benign
R5528:Lmo7 UTSW 14 101902086 missense probably damaging 1.00
R5588:Lmo7 UTSW 14 101896590 splice site probably null
R5643:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R5644:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R5650:Lmo7 UTSW 14 101898674 missense probably damaging 1.00
R5737:Lmo7 UTSW 14 101887236 missense probably damaging 1.00
R5832:Lmo7 UTSW 14 101884213 missense probably damaging 1.00
R5966:Lmo7 UTSW 14 101900502 missense possibly damaging 0.92
R6026:Lmo7 UTSW 14 101880990 missense probably benign 0.04
R6072:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R6158:Lmo7 UTSW 14 101900137 missense probably benign 0.03
R6246:Lmo7 UTSW 14 101918700 missense probably damaging 1.00
R6335:Lmo7 UTSW 14 101900636 missense probably damaging 1.00
R6620:Lmo7 UTSW 14 101875452 missense probably benign 0.29
R6658:Lmo7 UTSW 14 101910845 missense possibly damaging 0.84
R6917:Lmo7 UTSW 14 101918010 missense probably damaging 1.00
R7064:Lmo7 UTSW 14 101884179 missense probably damaging 1.00
R7072:Lmo7 UTSW 14 101898700 critical splice donor site probably null
R7121:Lmo7 UTSW 14 101887035 missense probably damaging 1.00
R7136:Lmo7 UTSW 14 101920539 missense unknown
R7196:Lmo7 UTSW 14 101896500 missense possibly damaging 0.75
R7228:Lmo7 UTSW 14 101896535 missense probably damaging 0.99
R7337:Lmo7 UTSW 14 101884204 missense probably damaging 0.98
R7341:Lmo7 UTSW 14 101885512 missense probably benign 0.30
R7408:Lmo7 UTSW 14 101880953 missense probably damaging 1.00
R7432:Lmo7 UTSW 14 101902115 missense probably benign 0.42
R7470:Lmo7 UTSW 14 101900604 missense possibly damaging 0.83
R7559:Lmo7 UTSW 14 101887226 nonsense probably null
R7565:Lmo7 UTSW 14 101885301 missense probably damaging 0.98
R7788:Lmo7 UTSW 14 101898576 missense possibly damaging 0.64
R8095:Lmo7 UTSW 14 101887419 missense possibly damaging 0.88
R8100:Lmo7 UTSW 14 101900463 missense probably benign 0.33
R8121:Lmo7 UTSW 14 101926300 missense unknown
R8308:Lmo7 UTSW 14 101902371 critical splice donor site probably null
R8371:Lmo7 UTSW 14 101887008 missense possibly damaging 0.95
X0066:Lmo7 UTSW 14 101887461 missense probably damaging 1.00
X0067:Lmo7 UTSW 14 101886933 splice site probably null
Z1176:Lmo7 UTSW 14 101884306 missense probably damaging 0.99
Z1176:Lmo7 UTSW 14 101919281 missense probably benign 0.00
Z1176:Lmo7 UTSW 14 101919443 missense unknown
Z1176:Lmo7 UTSW 14 101929228 missense unknown
Z1177:Lmo7 UTSW 14 101896518 missense possibly damaging 0.96
Z1177:Lmo7 UTSW 14 101898557 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAAGTCAGAAGCTGCAGG -3'
(R):5'- TTGATGTTGGGAAGCCAGC -3'

Sequencing Primer
(F):5'- TCAGAAGCTGCAGGAACTTG -3'
(R):5'- CAAAGGCTCTGTTGAATTATTTGG -3'
Posted On2019-10-17