Incidental Mutation 'R7506:Sorcs1'
ID581828
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Namesortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R7506 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location50143299-50678646 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 50182674 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 925 (W925*)
Ref Sequence ENSEMBL: ENSMUSP00000147463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]
Predicted Effect probably null
Transcript: ENSMUST00000072685
AA Change: W925*
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: W925*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111756
AA Change: W925*
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: W925*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164039
AA Change: W925*
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: W925*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168357
SMART Domains Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
VPS10 1 320 6.99e-58 SMART
PKD 322 412 3.84e-1 SMART
PKD 420 498 8.63e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209413
AA Change: W925*
Predicted Effect probably null
Transcript: ENSMUST00000209783
AA Change: W925*
Predicted Effect probably null
Transcript: ENSMUST00000211008
AA Change: W925*
Predicted Effect probably null
Transcript: ENSMUST00000211687
AA Change: W925*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik C T 9: 15,297,906 V31I probably benign Het
4933430I17Rik T C 4: 62,532,261 V24A possibly damaging Het
Adamtsl3 A T 7: 82,514,978 R334W probably damaging Het
Aox1 G A 1: 58,049,403 C116Y probably damaging Het
B3gntl1 A T 11: 121,670,914 I74N probably damaging Het
Bicra C T 7: 15,988,213 V460M possibly damaging Het
Ccdc18 G A 5: 108,163,739 C437Y possibly damaging Het
Cdh6 A G 15: 13,034,310 S755P probably damaging Het
Crtc2 G T 3: 90,259,212 A165S probably damaging Het
Cwf19l2 C T 9: 3,456,775 H703Y probably damaging Het
Cyc1 C A 15: 76,343,685 T41K probably benign Het
Defb28 A T 2: 152,518,301 H12L possibly damaging Het
Dsg3 T A 18: 20,533,464 C577S probably benign Het
Ggt6 G T 11: 72,437,898 C408F possibly damaging Het
Gm3278 T A 14: 4,893,441 Y97N probably damaging Het
Gpr155 A G 2: 73,368,339 L412P probably damaging Het
Gucd1 T C 10: 75,511,185 H77R probably benign Het
Hat1 T A 2: 71,420,347 I158N probably damaging Het
Hhla1 C T 15: 65,936,382 W271* probably null Het
Hist1h2bg G A 13: 23,571,484 A18T unknown Het
Igsf10 T A 3: 59,319,354 L2299F probably damaging Het
Iqsec1 G T 6: 90,662,806 H983Q possibly damaging Het
Iqsec1 A G 6: 90,667,909 S914P probably damaging Het
Irx2 G T 13: 72,629,209 G50C probably damaging Het
Kif26b T C 1: 178,529,499 probably benign Het
Lmo7 A G 14: 101,919,609 E1405G unknown Het
Mdm2 T C 10: 117,690,691 D330G possibly damaging Het
Mgat5 A C 1: 127,366,455 D178A probably benign Het
Mier2 C A 10: 79,550,342 R25L probably benign Het
Mlip T C 9: 77,164,803 K257E probably damaging Het
Mtfr2 T C 10: 20,353,385 S80P probably benign Het
Ndst2 A G 14: 20,730,085 V29A probably benign Het
Negr1 T G 3: 157,069,233 Y195* probably null Het
Nptn T C 9: 58,618,873 L101P probably damaging Het
Nrip1 G A 16: 76,294,459 T70I probably damaging Het
Nrtn C T 17: 56,751,633 V123M probably damaging Het
Olfr59 A T 11: 74,289,123 H159L possibly damaging Het
Onecut1 T A 9: 74,863,240 F315Y possibly damaging Het
P4htm A G 9: 108,583,679 L198S probably damaging Het
Pappa A C 4: 65,231,182 I920L probably benign Het
Pcdhgb5 A C 18: 37,732,472 D440A probably damaging Het
Ppard A T 17: 28,298,761 N268Y possibly damaging Het
Rapgef6 T A 11: 54,636,171 S563T probably benign Het
Rtn3 T A 19: 7,429,753 E949D probably benign Het
Sf3a1 T C 11: 4,177,561 M629T probably benign Het
Slc39a8 T C 3: 135,884,306 I319T probably benign Het
Spag9 G A 11: 94,108,464 D1069N probably damaging Het
Taar7a A G 10: 23,992,994 V163A possibly damaging Het
Tmem150a G A 6: 72,356,770 probably null Het
Tnxb G A 17: 34,715,691 V2425I possibly damaging Het
Tppp2 A G 14: 51,920,601 K168E possibly damaging Het
Ttn T A 2: 76,889,468 D7099V unknown Het
Vmn1r41 A T 6: 89,747,177 R50* probably null Het
Vmn1r60 T C 7: 5,544,862 K80E Het
Vmn2r18 A G 5: 151,585,020 F213S possibly damaging Het
Vmn2r26 G A 6: 124,039,741 S388N probably benign Het
Vmn2r63 A T 7: 42,926,967 F474Y probably damaging Het
Zc3hav1 G A 6: 38,332,940 R316* probably null Het
Zfp654 A T 16: 64,791,848 I225N probably damaging Het
Zfp97 A G 17: 17,145,280 E347G probably damaging Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50190054 missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50176128 missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50228201 missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50288079 splice site probably benign
IGL01445:Sorcs1 APN 19 50153066 missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50181506 missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50230209 critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50288159 splice site probably benign
IGL02111:Sorcs1 APN 19 50230245 missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50333598 missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50182671 nonsense probably null
IGL02498:Sorcs1 APN 19 50678168 missense probably benign
IGL02658:Sorcs1 APN 19 50190092 missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50677930 nonsense probably null
IGL02942:Sorcs1 APN 19 50475437 missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50259756 nonsense probably null
IGL03230:Sorcs1 APN 19 50242093 missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50152907 missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50378891 splice site probably benign
R0115:Sorcs1 UTSW 19 50636453 intron probably benign
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50313042 splice site probably null
R0481:Sorcs1 UTSW 19 50636453 intron probably benign
R0581:Sorcs1 UTSW 19 50252701 missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50241942 splice site probably benign
R0980:Sorcs1 UTSW 19 50232323 missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50144160 unclassified probably benign
R1519:Sorcs1 UTSW 19 50252587 missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50475422 missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50175043 splice site probably benign
R1783:Sorcs1 UTSW 19 50228309 critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50222195 missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50678192 missense probably benign
R2206:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50210650 missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50151221 missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50222159 missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50190161 missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50378941 missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50312964 critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50182669 missense probably benign
R4780:Sorcs1 UTSW 19 50143981 unclassified probably benign
R4781:Sorcs1 UTSW 19 50182681 missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50678140 missense possibly damaging 0.92
R4823:Sorcs1 UTSW 19 50230302 missense possibly damaging 0.87
R4883:Sorcs1 UTSW 19 50232303 missense probably benign 0.00
R5091:Sorcs1 UTSW 19 50259752 critical splice donor site probably null
R5105:Sorcs1 UTSW 19 50225141 missense possibly damaging 0.57
R5437:Sorcs1 UTSW 19 50252602 missense probably benign 0.19
R5574:Sorcs1 UTSW 19 50222133 missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50182775 missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50190117 nonsense probably null
R6091:Sorcs1 UTSW 19 50288101 missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50288094 missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50181414 missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50144124 missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50225177 missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50176122 nonsense probably null
R6792:Sorcs1 UTSW 19 50678168 missense probably benign
R6891:Sorcs1 UTSW 19 50225119 nonsense probably null
R7151:Sorcs1 UTSW 19 50312982 missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50190042 missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50175157 missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50262263 missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50153112 missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50153052 missense probably benign
R7573:Sorcs1 UTSW 19 50152796 nonsense probably null
R7867:Sorcs1 UTSW 19 50230260 nonsense probably null
R7911:Sorcs1 UTSW 19 50144032 missense unknown
R7950:Sorcs1 UTSW 19 50230260 nonsense probably null
R7992:Sorcs1 UTSW 19 50144032 missense unknown
R8032:Sorcs1 UTSW 19 50475408 missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50143977 missense unknown
X0024:Sorcs1 UTSW 19 50182763 missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50222143 missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50226742 missense probably null 1.00
Z1177:Sorcs1 UTSW 19 50333599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACATGAGGTTACTGAGCAC -3'
(R):5'- CAGTACAATGTCCCTTCTTTACAG -3'

Sequencing Primer
(F):5'- TACTGAGCACATATGGCCTG -3'
(R):5'- CCAATTCACAATCTTGGGGTTCACAG -3'
Posted On2019-10-17