Incidental Mutation 'R7507:Zfp451'
ID581829
Institutional Source Beutler Lab
Gene Symbol Zfp451
Ensembl Gene ENSMUSG00000042197
Gene Namezinc finger protein 451
Synonyms4930515K21Rik, Kiaa0576-hp, 4933435G09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7507 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location33761545-33814595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33769759 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1007 (M1007K)
Ref Sequence ENSEMBL: ENSMUSP00000019861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019861] [ENSMUST00000139143]
Predicted Effect probably damaging
Transcript: ENSMUST00000019861
AA Change: M1007K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000019861
Gene: ENSMUSG00000042197
AA Change: M1007K

DomainStartEndE-ValueType
coiled coil region 81 109 N/A INTRINSIC
ZnF_C2H2 169 195 1.63e1 SMART
ZnF_C2H2 212 232 1.18e2 SMART
ZnF_C2H2 253 277 1.73e0 SMART
ZnF_C2H2 315 335 2.03e2 SMART
ZnF_C2H2 362 385 3.75e1 SMART
ZnF_C2H2 494 517 2.91e-2 SMART
ZnF_C2H2 527 550 5.4e1 SMART
low complexity region 558 577 N/A INTRINSIC
ZnF_C2H2 604 629 1.55e1 SMART
ZnF_C2H2 634 657 2.29e0 SMART
ZnF_C2H2 665 687 1.64e-1 SMART
ZnF_C2H2 751 774 6.75e0 SMART
ZnF_C2H2 787 810 4.94e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139143
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Zfp451
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Zfp451 APN 1 33786540 intron probably benign
IGL00423:Zfp451 APN 1 33777579 missense probably benign 0.44
IGL00925:Zfp451 APN 1 33776261 unclassified probably benign
IGL00971:Zfp451 APN 1 33783153 missense probably benign 0.01
IGL01521:Zfp451 APN 1 33777331 splice site probably null
IGL01672:Zfp451 APN 1 33762166 missense probably benign 0.33
IGL01826:Zfp451 APN 1 33782162 missense probably damaging 1.00
IGL02298:Zfp451 APN 1 33772921 missense probably damaging 0.98
IGL02343:Zfp451 APN 1 33776493 missense probably damaging 1.00
IGL03150:Zfp451 APN 1 33777454 missense probably damaging 1.00
IGL03257:Zfp451 APN 1 33777048 missense possibly damaging 0.90
R0006:Zfp451 UTSW 1 33802780 intron probably benign
R0068:Zfp451 UTSW 1 33777625 missense probably damaging 1.00
R0068:Zfp451 UTSW 1 33777625 missense probably damaging 1.00
R0358:Zfp451 UTSW 1 33777729 missense probably damaging 1.00
R0441:Zfp451 UTSW 1 33777045 missense probably damaging 0.96
R0483:Zfp451 UTSW 1 33770910 splice site probably benign
R0745:Zfp451 UTSW 1 33770848 nonsense probably null
R1469:Zfp451 UTSW 1 33769813 missense possibly damaging 0.93
R1469:Zfp451 UTSW 1 33769813 missense possibly damaging 0.93
R1486:Zfp451 UTSW 1 33777727 missense probably damaging 0.99
R1774:Zfp451 UTSW 1 33813768 missense probably benign 0.02
R1929:Zfp451 UTSW 1 33782193 missense probably damaging 1.00
R1929:Zfp451 UTSW 1 33783856 missense probably benign 0.12
R1933:Zfp451 UTSW 1 33777822 missense probably damaging 1.00
R2108:Zfp451 UTSW 1 33779167 missense possibly damaging 0.93
R2225:Zfp451 UTSW 1 33770907 splice site probably benign
R2372:Zfp451 UTSW 1 33780052 splice site probably null
R3923:Zfp451 UTSW 1 33779045 missense probably null 1.00
R4295:Zfp451 UTSW 1 33777755 missense probably damaging 0.99
R4409:Zfp451 UTSW 1 33777413 missense probably damaging 1.00
R4617:Zfp451 UTSW 1 33802671 intron probably benign
R4757:Zfp451 UTSW 1 33765858 missense probably damaging 0.98
R4777:Zfp451 UTSW 1 33782105 missense possibly damaging 0.80
R4906:Zfp451 UTSW 1 33805384 missense probably damaging 1.00
R4964:Zfp451 UTSW 1 33777861 missense probably damaging 1.00
R5128:Zfp451 UTSW 1 33802933 intron probably benign
R5129:Zfp451 UTSW 1 33802933 intron probably benign
R5383:Zfp451 UTSW 1 33813806 missense probably damaging 1.00
R5446:Zfp451 UTSW 1 33777528 missense probably damaging 1.00
R6154:Zfp451 UTSW 1 33803546 intron probably benign
R6228:Zfp451 UTSW 1 33803138 intron probably benign
R6272:Zfp451 UTSW 1 33803244 intron probably benign
R6296:Zfp451 UTSW 1 33769817 nonsense probably null
R6321:Zfp451 UTSW 1 33813735 missense probably damaging 1.00
R6445:Zfp451 UTSW 1 33773011 missense probably damaging 1.00
R6528:Zfp451 UTSW 1 33777781 missense probably damaging 1.00
R6562:Zfp451 UTSW 1 33762179 missense possibly damaging 0.90
R6739:Zfp451 UTSW 1 33803594 intron probably benign
R6911:Zfp451 UTSW 1 33803456 intron probably benign
R7042:Zfp451 UTSW 1 33777393 missense probably damaging 1.00
R7044:Zfp451 UTSW 1 33802167 intron probably benign
R7071:Zfp451 UTSW 1 33776744 missense possibly damaging 0.96
R7082:Zfp451 UTSW 1 33772891 critical splice donor site probably null
R7123:Zfp451 UTSW 1 33776869 missense probably damaging 1.00
R7149:Zfp451 UTSW 1 33777324 missense probably damaging 1.00
R7179:Zfp451 UTSW 1 33802570 missense unknown
R7185:Zfp451 UTSW 1 33769893 missense probably damaging 1.00
R7228:Zfp451 UTSW 1 33803394 missense unknown
R7402:Zfp451 UTSW 1 33813762 missense probably benign
R7462:Zfp451 UTSW 1 33777013 missense probably damaging 1.00
R7488:Zfp451 UTSW 1 33779140 missense probably benign 0.22
R7774:Zfp451 UTSW 1 33805393 missense probably benign 0.20
R7835:Zfp451 UTSW 1 33772979 missense probably damaging 1.00
R7979:Zfp451 UTSW 1 33782138 missense probably benign 0.01
R8123:Zfp451 UTSW 1 33762167 missense possibly damaging 0.92
R8137:Zfp451 UTSW 1 33782075 missense possibly damaging 0.57
RF005:Zfp451 UTSW 1 33776792 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTATAAGAGATCCTGCTCAAAG -3'
(R):5'- GTACCGTTTGTTCCAACTTAGGC -3'

Sequencing Primer
(F):5'- TCAAAGCAAACAAACAAGATGTAAG -3'
(R):5'- AACTTAGGCTGGCCGTCTAG -3'
Posted On2019-10-17