Incidental Mutation 'R7507:Mgat4a'
ID581830
Institutional Source Beutler Lab
Gene Symbol Mgat4a
Ensembl Gene ENSMUSG00000026110
Gene Namemannoside acetylglucosaminyltransferase 4, isoenzyme A
Synonyms9530018I07Rik, GnT-IVa
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R7507 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location37439340-37541016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37452527 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 375 (L375F)
Ref Sequence ENSEMBL: ENSMUSP00000038894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042161] [ENSMUST00000143636] [ENSMUST00000151952] [ENSMUST00000154819]
Predicted Effect probably damaging
Transcript: ENSMUST00000042161
AA Change: L375F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038894
Gene: ENSMUSG00000026110
AA Change: L375F

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
coiled coil region 28 63 N/A INTRINSIC
Pfam:Glyco_transf_54 75 380 5.8e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143636
AA Change: L237F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122909
Gene: ENSMUSG00000026110
AA Change: L237F

DomainStartEndE-ValueType
Pfam:Glyco_transf_54 1 242 1.2e-123 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151952
AA Change: L375F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114175
Gene: ENSMUSG00000026110
AA Change: L375F

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
coiled coil region 28 63 N/A INTRINSIC
Pfam:Glyco_transf_54 86 380 7.5e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154819
AA Change: L366F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121181
Gene: ENSMUSG00000026110
AA Change: L366F

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
coiled coil region 28 63 N/A INTRINSIC
Pfam:Glyco_transf_54 71 371 4.8e-137 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a key glycosyltransferase that regulates the formation of tri- and multiantennary branching structures in the Golgi apparatus. The encoded protein, in addition to the related isoenzyme B, catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc in a beta-1,4 linkage to the Man-alpha-1,3-Man-beta-1,4-GlcNAc arm of R-Man-alpha-1,6(GlcNAc-beta-1,2-Man-alpha-1,3)Man-beta-1,4-GlcNAc-beta-1,4-GlcNAc-beta-1-Asn. The encoded protein may play a role in regulating the availability of serum glycoproteins, oncogenesis, and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show defects in glucose-stimulated insulin secretion, impaired cellular glucose import, increased susceptibility to weight gain, hyperglycemia, impaired glucose tolerance, insulin resistance, high free fatty acid and triglyceride levels, and hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Mgat4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Mgat4a APN 1 37449123 nonsense probably null
IGL01720:Mgat4a APN 1 37444898 missense probably damaging 1.00
IGL02103:Mgat4a APN 1 37462926 missense possibly damaging 0.94
IGL03177:Mgat4a APN 1 37444887 missense probably damaging 1.00
R0090:Mgat4a UTSW 1 37490333 missense probably damaging 1.00
R0269:Mgat4a UTSW 1 37490307 missense possibly damaging 0.89
R0635:Mgat4a UTSW 1 37452294 missense probably benign 0.11
R1114:Mgat4a UTSW 1 37464406 splice site probably benign
R1120:Mgat4a UTSW 1 37452581 missense probably damaging 1.00
R1466:Mgat4a UTSW 1 37464406 splice site probably benign
R1940:Mgat4a UTSW 1 37536037 critical splice donor site probably null
R2257:Mgat4a UTSW 1 37490313 missense probably benign 0.13
R2293:Mgat4a UTSW 1 37452592 missense probably damaging 0.99
R2370:Mgat4a UTSW 1 37464533 missense probably damaging 0.96
R2392:Mgat4a UTSW 1 37498704 missense probably damaging 1.00
R3952:Mgat4a UTSW 1 37450414 splice site probably benign
R4563:Mgat4a UTSW 1 37466579 missense probably damaging 1.00
R5424:Mgat4a UTSW 1 37466555 missense probably benign 0.01
R5494:Mgat4a UTSW 1 37454817 missense probably damaging 1.00
R5505:Mgat4a UTSW 1 37495954 missense probably benign 0.04
R5938:Mgat4a UTSW 1 37452263 missense probably damaging 0.99
R6237:Mgat4a UTSW 1 37456592 missense probably damaging 1.00
R6589:Mgat4a UTSW 1 37444895 missense probably damaging 0.99
R6817:Mgat4a UTSW 1 37449123 nonsense probably null
R6825:Mgat4a UTSW 1 37464434 nonsense probably null
R7402:Mgat4a UTSW 1 37454784 missense probably damaging 1.00
R7789:Mgat4a UTSW 1 37490279 missense probably damaging 0.97
R8835:Mgat4a UTSW 1 37452291 missense possibly damaging 0.91
X0063:Mgat4a UTSW 1 37462890 critical splice donor site probably null
Z1177:Mgat4a UTSW 1 37490372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTAGGTCTTCTCCAGGGTG -3'
(R):5'- TATGCCAACTGACAGGACTCTC -3'

Sequencing Primer
(F):5'- CTTGGTACACCTTCAGGGAG -3'
(R):5'- CAAACCTACGAATCCGCTT -3'
Posted On2019-10-17