Incidental Mutation 'R7507:Stat4'
ID 581831
Institutional Source Beutler Lab
Gene Symbol Stat4
Ensembl Gene ENSMUSG00000062939
Gene Name signal transducer and activator of transcription 4
Synonyms
MMRRC Submission 045580-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R7507 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 52026307-52146348 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 52117733 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 288 (Y288C)
Ref Sequence ENSEMBL: ENSMUSP00000027277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027277] [ENSMUST00000168302]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000027277
AA Change: Y288C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027277
Gene: ENSMUSG00000062939
AA Change: Y288C

DomainStartEndE-ValueType
STAT_int 2 122 3.73e-60 SMART
Pfam:STAT_alpha 140 314 2.2e-54 PFAM
Pfam:STAT_bind 316 562 4.7e-76 PFAM
SH2 571 681 9.07e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168302
AA Change: Y288C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130713
Gene: ENSMUSG00000062939
AA Change: Y288C

DomainStartEndE-ValueType
STAT_int 2 122 3.73e-60 SMART
Pfam:STAT_alpha 137 314 8.2e-66 PFAM
Pfam:STAT_bind 316 563 3.3e-114 PFAM
SH2 571 681 9.07e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. Homozygous knockout mice for this gene exhibit reduced inflammation and cytokine production in response to immune challenge. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to altered cytokine production of T-cells, impaired IL-12 responses, enhanced Th2 cell development, decreased susceptibility to autoimmune diabetes, altered NK cell responses during viral infection, and increased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,652,177 (GRCm39) T1359S probably benign Het
Adam8 C T 7: 139,567,091 (GRCm39) probably null Het
Adnp2 A G 18: 80,174,068 (GRCm39) S114P probably benign Het
BC051019 T A 7: 109,315,475 (GRCm39) D260V possibly damaging Het
Btnl10 A G 11: 58,811,384 (GRCm39) T236A probably benign Het
Cacna1c A T 6: 119,034,200 (GRCm39) L109Q Het
Clint1 C A 11: 45,799,776 (GRCm39) Q512K possibly damaging Het
Dop1a A G 9: 86,418,002 (GRCm39) N1957S probably benign Het
Gosr1 A T 11: 76,645,240 (GRCm39) N101K probably benign Het
Gria1 A G 11: 57,119,765 (GRCm39) T350A probably benign Het
Hs3st5 T A 10: 36,709,011 (GRCm39) V182D probably damaging Het
Igkv4-80 G T 6: 68,993,677 (GRCm39) S71R probably benign Het
Kif2b A G 11: 91,468,269 (GRCm39) F5L probably benign Het
Med1 A G 11: 98,048,852 (GRCm39) L648P probably damaging Het
Mgat4a G A 1: 37,491,608 (GRCm39) L375F probably damaging Het
Mlph A T 1: 90,855,429 (GRCm39) probably benign Het
Nbeal1 T C 1: 60,274,626 (GRCm39) S346P probably damaging Het
Nhlrc2 G A 19: 56,585,810 (GRCm39) V682I not run Het
Nos3 T C 5: 24,577,642 (GRCm39) M552T probably damaging Het
Or4e2 A G 14: 52,687,930 (GRCm39) N20S probably benign Het
Or5w19 T C 2: 87,698,713 (GRCm39) I126T probably damaging Het
Or6c209 T A 10: 129,483,366 (GRCm39) I123N probably damaging Het
Pcdha5 A T 18: 37,093,909 (GRCm39) R139S probably benign Het
Pik3r1 G A 13: 101,845,490 (GRCm39) S147L probably benign Het
Plppr4 T A 3: 117,115,754 (GRCm39) H701L possibly damaging Het
Pnpla1 T C 17: 29,095,791 (GRCm39) Y71H probably damaging Het
Ppp1r12c G A 7: 4,486,970 (GRCm39) A521V probably benign Het
Rasgrp3 C A 17: 75,804,055 (GRCm39) D119E probably damaging Het
Rnf216 A T 5: 143,075,557 (GRCm39) D342E probably damaging Het
Rnpc3 A T 3: 113,410,410 (GRCm39) S294T probably benign Het
Sepsecs A G 5: 52,801,397 (GRCm39) F422L probably damaging Het
Sgcz T A 8: 38,420,200 (GRCm39) E17D probably benign Het
Slc2a5 T C 4: 150,210,107 (GRCm39) Y31H probably damaging Het
Spag9 A G 11: 93,958,906 (GRCm39) E310G probably benign Het
Tet1 A G 10: 62,668,671 (GRCm39) probably null Het
Trim62 A G 4: 128,790,664 (GRCm39) T154A probably benign Het
Tubb4a T C 17: 57,388,642 (GRCm39) D128G probably damaging Het
Ube3d G A 9: 86,304,939 (GRCm39) A301V possibly damaging Het
Utp6 A G 11: 79,833,012 (GRCm39) S444P possibly damaging Het
Vasn T C 16: 4,467,345 (GRCm39) C431R probably damaging Het
Zfp260 T C 7: 29,804,291 (GRCm39) S64P probably damaging Het
Zfp451 A T 1: 33,808,840 (GRCm39) M1007K probably damaging Het
Zfp606 C A 7: 12,226,868 (GRCm39) Q330K probably benign Het
Other mutations in Stat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Stat4 APN 1 52,142,037 (GRCm39) missense probably damaging 1.00
IGL00482:Stat4 APN 1 52,113,856 (GRCm39) missense probably benign 0.05
IGL01395:Stat4 APN 1 52,051,033 (GRCm39) missense probably damaging 1.00
IGL01533:Stat4 APN 1 52,137,578 (GRCm39) missense probably damaging 1.00
IGL01943:Stat4 APN 1 52,136,014 (GRCm39) missense possibly damaging 0.94
IGL02114:Stat4 APN 1 52,142,024 (GRCm39) missense probably damaging 1.00
IGL02151:Stat4 APN 1 52,053,029 (GRCm39) missense probably damaging 0.99
IGL02601:Stat4 APN 1 52,137,574 (GRCm39) missense probably damaging 1.00
R0016:Stat4 UTSW 1 52,107,939 (GRCm39) missense probably benign 0.01
R0243:Stat4 UTSW 1 52,051,016 (GRCm39) missense probably benign 0.22
R0329:Stat4 UTSW 1 52,130,029 (GRCm39) intron probably benign
R0973:Stat4 UTSW 1 52,135,979 (GRCm39) missense probably damaging 0.99
R1144:Stat4 UTSW 1 52,123,288 (GRCm39) splice site probably benign
R1187:Stat4 UTSW 1 52,115,836 (GRCm39) missense probably damaging 1.00
R1331:Stat4 UTSW 1 52,053,086 (GRCm39) missense probably benign 0.20
R1401:Stat4 UTSW 1 52,111,106 (GRCm39) splice site probably benign
R1529:Stat4 UTSW 1 52,050,952 (GRCm39) missense probably damaging 1.00
R1711:Stat4 UTSW 1 52,146,084 (GRCm39) missense probably damaging 1.00
R2213:Stat4 UTSW 1 52,053,014 (GRCm39) missense probably damaging 0.98
R3003:Stat4 UTSW 1 52,142,145 (GRCm39) missense probably damaging 1.00
R3683:Stat4 UTSW 1 52,052,981 (GRCm39) missense possibly damaging 0.89
R3789:Stat4 UTSW 1 52,050,955 (GRCm39) missense probably benign 0.07
R3919:Stat4 UTSW 1 52,135,981 (GRCm39) missense possibly damaging 0.62
R4320:Stat4 UTSW 1 52,113,866 (GRCm39) missense probably benign
R4373:Stat4 UTSW 1 52,111,100 (GRCm39) critical splice donor site probably null
R5024:Stat4 UTSW 1 52,121,729 (GRCm39) missense possibly damaging 0.80
R5103:Stat4 UTSW 1 52,111,054 (GRCm39) missense probably damaging 0.97
R5206:Stat4 UTSW 1 52,144,395 (GRCm39) missense probably damaging 0.99
R5944:Stat4 UTSW 1 52,113,898 (GRCm39) missense probably damaging 1.00
R5961:Stat4 UTSW 1 52,104,543 (GRCm39) missense possibly damaging 0.50
R6001:Stat4 UTSW 1 52,136,026 (GRCm39) missense probably damaging 0.96
R6161:Stat4 UTSW 1 52,113,836 (GRCm39) missense possibly damaging 0.94
R6262:Stat4 UTSW 1 52,141,360 (GRCm39) missense probably null 1.00
R6701:Stat4 UTSW 1 52,142,133 (GRCm39) missense probably damaging 1.00
R6767:Stat4 UTSW 1 52,115,742 (GRCm39) missense probably benign 0.00
R6989:Stat4 UTSW 1 52,107,974 (GRCm39) missense probably benign 0.09
R7539:Stat4 UTSW 1 52,110,868 (GRCm39) splice site probably null
R7546:Stat4 UTSW 1 52,137,622 (GRCm39) missense probably damaging 0.98
R7616:Stat4 UTSW 1 52,053,037 (GRCm39) nonsense probably null
R7751:Stat4 UTSW 1 52,121,711 (GRCm39) missense possibly damaging 0.73
R8052:Stat4 UTSW 1 52,118,932 (GRCm39) missense probably damaging 1.00
R8311:Stat4 UTSW 1 52,142,075 (GRCm39) missense probably damaging 1.00
R8419:Stat4 UTSW 1 52,137,637 (GRCm39) missense possibly damaging 0.89
R8679:Stat4 UTSW 1 52,118,991 (GRCm39) missense probably null 1.00
R8699:Stat4 UTSW 1 52,111,096 (GRCm39) missense probably benign
R8738:Stat4 UTSW 1 52,115,711 (GRCm39) missense possibly damaging 0.95
R8921:Stat4 UTSW 1 52,144,892 (GRCm39) missense probably benign 0.39
R9013:Stat4 UTSW 1 52,050,957 (GRCm39) missense probably benign 0.00
R9237:Stat4 UTSW 1 52,146,073 (GRCm39) missense probably benign
R9729:Stat4 UTSW 1 52,141,762 (GRCm39) missense possibly damaging 0.94
R9767:Stat4 UTSW 1 52,141,653 (GRCm39) missense probably damaging 1.00
Z1177:Stat4 UTSW 1 52,137,644 (GRCm39) missense probably null 1.00
Z1177:Stat4 UTSW 1 52,123,258 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGATGCCTGTAAATTGAAAGCAC -3'
(R):5'- GCTTTCTGGAGGCAATATTCTC -3'

Sequencing Primer
(F):5'- GCCTGTAAATTGAAAGCACAAATTAG -3'
(R):5'- TGGAGGCAATATTCTCTACTGTC -3'
Posted On 2019-10-17