Incidental Mutation 'R7507:Olfr1152'
ID581833
Institutional Source Beutler Lab
Gene Symbol Olfr1152
Ensembl Gene ENSMUSG00000045225
Gene Nameolfactory receptor 1152
SynonymsMOR177-12, GA_x6K02T2Q125-49372426-49373358
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R7507 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87866492-87874156 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87868369 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 126 (I126T)
Ref Sequence ENSEMBL: ENSMUSP00000151045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051058] [ENSMUST00000213308]
Predicted Effect probably damaging
Transcript: ENSMUST00000051058
AA Change: I126T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054645
Gene: ENSMUSG00000045225
AA Change: I126T

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 4e-46 PFAM
Pfam:7tm_1 40 290 1e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213308
AA Change: I126T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Olfr1152
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01418:Olfr1152 APN 2 87868465 missense probably benign 0.00
IGL01618:Olfr1152 APN 2 87868144 missense probably damaging 0.96
IGL02326:Olfr1152 APN 2 87868675 missense probably damaging 1.00
IGL03162:Olfr1152 APN 2 87868140 missense probably benign 0.00
IGL03189:Olfr1152 APN 2 87868215 missense possibly damaging 0.76
I2288:Olfr1152 UTSW 2 87868135 missense probably damaging 1.00
R0761:Olfr1152 UTSW 2 87868536 missense possibly damaging 0.88
R1558:Olfr1152 UTSW 2 87868115 missense probably damaging 1.00
R1938:Olfr1152 UTSW 2 87868461 missense probably benign 0.01
R3810:Olfr1152 UTSW 2 87868401 missense probably damaging 1.00
R3812:Olfr1152 UTSW 2 87868401 missense probably damaging 1.00
R4728:Olfr1152 UTSW 2 87868435 missense probably benign 0.13
R4928:Olfr1152 UTSW 2 87868230 missense probably benign 0.32
R5172:Olfr1152 UTSW 2 87868827 missense probably benign 0.20
R5174:Olfr1152 UTSW 2 87868411 missense possibly damaging 0.79
R6147:Olfr1152 UTSW 2 87868717 missense probably benign 0.03
R6195:Olfr1152 UTSW 2 87868560 missense possibly damaging 0.63
R6233:Olfr1152 UTSW 2 87868560 missense possibly damaging 0.63
R6541:Olfr1152 UTSW 2 87868294 missense probably benign 0.11
R8068:Olfr1152 UTSW 2 87868651 missense probably benign 0.20
R8407:Olfr1152 UTSW 2 87868093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTACTCCTCTGCAGTTGG -3'
(R):5'- ATGGTGCTCAGTTCAATGAAAC -3'

Sequencing Primer
(F):5'- TCCTCTGCAGTTGGACCAAAGATG -3'
(R):5'- CTCATTGACTTGTATGTCAGAGCAG -3'
Posted On2019-10-17