Incidental Mutation 'R7507:Slc2a5'
ID581837
Institutional Source Beutler Lab
Gene Symbol Slc2a5
Ensembl Gene ENSMUSG00000028976
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 5
SynonymsGLUT5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R7507 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location150119283-150144169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150125650 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 31 (Y31H)
Ref Sequence ENSEMBL: ENSMUSP00000030826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030826]
Predicted Effect probably damaging
Transcript: ENSMUST00000030826
AA Change: Y31H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030826
Gene: ENSMUSG00000028976
AA Change: Y31H

DomainStartEndE-ValueType
Pfam:MFS_1 16 397 1e-19 PFAM
Pfam:Sugar_tr 19 474 2.1e-138 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a fructose transporter responsible for fructose uptake by the small intestine. The encoded protein also is necessary for the increase in blood pressure due to high dietary fructose consumption. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal cochlear morphology and physiology with no detectable alterations in outer hair cell morphology, electromotility or nonlinear capacitance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Slc2a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Slc2a5 APN 4 150125656 missense probably damaging 1.00
IGL01071:Slc2a5 APN 4 150120733 utr 5 prime probably benign
IGL01977:Slc2a5 APN 4 150142218 missense probably damaging 0.97
IGL03271:Slc2a5 APN 4 150135583 missense probably damaging 1.00
BB006:Slc2a5 UTSW 4 150139485 missense probably benign 0.39
BB016:Slc2a5 UTSW 4 150139485 missense probably benign 0.39
R0760:Slc2a5 UTSW 4 150139667 missense probably benign
R0906:Slc2a5 UTSW 4 150142830 missense probably benign 0.21
R1099:Slc2a5 UTSW 4 150142179 missense probably benign 0.01
R1809:Slc2a5 UTSW 4 150143057 missense probably damaging 1.00
R2099:Slc2a5 UTSW 4 150143177 nonsense probably null
R2152:Slc2a5 UTSW 4 150125638 missense probably damaging 1.00
R2253:Slc2a5 UTSW 4 150139990 missense possibly damaging 0.78
R2696:Slc2a5 UTSW 4 150120746 missense probably benign
R4835:Slc2a5 UTSW 4 150140005 missense probably benign 0.06
R4926:Slc2a5 UTSW 4 150120742 nonsense probably null
R5123:Slc2a5 UTSW 4 150139805 nonsense probably null
R5397:Slc2a5 UTSW 4 150139823 splice site probably null
R6209:Slc2a5 UTSW 4 150143100 missense probably benign 0.00
R6342:Slc2a5 UTSW 4 150139526 missense possibly damaging 0.93
R6547:Slc2a5 UTSW 4 150135619 missense possibly damaging 0.94
R7340:Slc2a5 UTSW 4 150139982 missense probably benign 0.44
R7537:Slc2a5 UTSW 4 150129069 missense possibly damaging 0.89
R7572:Slc2a5 UTSW 4 150142185 missense probably benign 0.33
R7751:Slc2a5 UTSW 4 150143134 missense probably damaging 1.00
R7929:Slc2a5 UTSW 4 150139485 missense probably benign 0.39
R8058:Slc2a5 UTSW 4 150143133 missense probably damaging 1.00
R8318:Slc2a5 UTSW 4 150139658 missense possibly damaging 0.90
R8477:Slc2a5 UTSW 4 150125662 missense probably benign 0.09
R8498:Slc2a5 UTSW 4 150126133 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAGAGCCTGTTGTCACCTC -3'
(R):5'- GCACGTCCATGAGAAGCTGAAG -3'

Sequencing Primer
(F):5'- AGAGCCTGTTGTCACCTCAATGG -3'
(R):5'- AGGACTTGGTCATTCACATGGC -3'
Posted On2019-10-17