Incidental Mutation 'R7507:Nos3'
ID581838
Institutional Source Beutler Lab
Gene Symbol Nos3
Ensembl Gene ENSMUSG00000028978
Gene Namenitric oxide synthase 3, endothelial cell
SynonymseNOS, 2310065A03Rik, ecNOS, Nos-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7507 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location24364810-24384474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24372644 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 552 (M552T)
Ref Sequence ENSEMBL: ENSMUSP00000030834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030834] [ENSMUST00000115090]
Predicted Effect probably damaging
Transcript: ENSMUST00000030834
AA Change: M552T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030834
Gene: ENSMUSG00000028978
AA Change: M552T

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
Pfam:NO_synthase 118 480 1.7e-183 PFAM
Pfam:Flavodoxin_1 521 697 4.8e-54 PFAM
Pfam:FAD_binding_1 750 978 2.1e-82 PFAM
Pfam:NAD_binding_1 1010 1124 1.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115090
AA Change: M552T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110742
Gene: ENSMUSG00000028978
AA Change: M552T

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
Pfam:NO_synthase 114 485 9e-214 PFAM
Pfam:Flavodoxin_1 521 697 3.8e-54 PFAM
Pfam:FAD_binding_1 750 978 1.6e-79 PFAM
Pfam:NAD_binding_1 1010 1091 5.6e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. Nitric oxide is synthesized from L-arginine by nitric oxide synthases. Variations in this gene are associated with susceptibility to coronary spasm. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced survival, hypertension, inhibited basal vasodilation, insulin resistance, fewer mitochondria, reduced heart rate, impaired ovulation and, in some, shortened limbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Nos3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Nos3 APN 5 24369862 missense probably damaging 1.00
IGL02059:Nos3 APN 5 24368998 missense probably damaging 1.00
IGL02354:Nos3 APN 5 24367623 missense probably damaging 1.00
IGL02361:Nos3 APN 5 24367623 missense probably damaging 1.00
IGL02936:Nos3 APN 5 24380993 missense probably damaging 0.97
IGL03190:Nos3 APN 5 24383629 missense probably damaging 1.00
paul UTSW 5 24372704 missense probably damaging 1.00
Peter UTSW 5 24377855 missense probably damaging 0.99
R0111:Nos3 UTSW 5 24372704 missense probably damaging 1.00
R0387:Nos3 UTSW 5 24367585 missense probably damaging 1.00
R0755:Nos3 UTSW 5 24367297 missense probably damaging 1.00
R1156:Nos3 UTSW 5 24377619 missense probably benign 0.21
R1597:Nos3 UTSW 5 24368997 missense probably damaging 1.00
R1671:Nos3 UTSW 5 24383840 missense probably damaging 1.00
R1743:Nos3 UTSW 5 24377312 missense probably benign 0.22
R1830:Nos3 UTSW 5 24370133 missense probably damaging 1.00
R1882:Nos3 UTSW 5 24368820 missense probably damaging 1.00
R2294:Nos3 UTSW 5 24364857 missense probably damaging 0.99
R3114:Nos3 UTSW 5 24372631 splice site probably benign
R3978:Nos3 UTSW 5 24377931 missense probably damaging 1.00
R3980:Nos3 UTSW 5 24377931 missense probably damaging 1.00
R4016:Nos3 UTSW 5 24371716 missense probably damaging 1.00
R4905:Nos3 UTSW 5 24367331 missense probably benign 0.01
R4947:Nos3 UTSW 5 24377855 missense probably damaging 0.99
R5017:Nos3 UTSW 5 24366719 intron probably benign
R5095:Nos3 UTSW 5 24368918 splice site probably benign
R5096:Nos3 UTSW 5 24371957 missense probably damaging 1.00
R5102:Nos3 UTSW 5 24371627 missense probably damaging 1.00
R5311:Nos3 UTSW 5 24377345 missense probably benign 0.19
R5330:Nos3 UTSW 5 24369904 missense probably damaging 1.00
R5367:Nos3 UTSW 5 24371944 missense probably benign 0.00
R5394:Nos3 UTSW 5 24383890 missense probably benign 0.00
R5574:Nos3 UTSW 5 24368861 missense possibly damaging 0.80
R5889:Nos3 UTSW 5 24368777 intron probably benign
R6032:Nos3 UTSW 5 24379811 missense probably benign
R6032:Nos3 UTSW 5 24379811 missense probably benign
R6401:Nos3 UTSW 5 24379811 missense probably benign
R6517:Nos3 UTSW 5 24383624 missense probably damaging 1.00
R6888:Nos3 UTSW 5 24383335 missense possibly damaging 0.86
R6972:Nos3 UTSW 5 24380243 missense probably benign
R6973:Nos3 UTSW 5 24380243 missense probably benign
R7432:Nos3 UTSW 5 24367615 missense probably damaging 0.98
R7434:Nos3 UTSW 5 24382635 missense probably damaging 0.99
R7553:Nos3 UTSW 5 24381717 missense possibly damaging 0.62
R7652:Nos3 UTSW 5 24383612 missense probably damaging 1.00
R8094:Nos3 UTSW 5 24367220 missense probably benign 0.13
R8686:Nos3 UTSW 5 24368843 missense possibly damaging 0.83
R8794:Nos3 UTSW 5 24371747 missense probably damaging 1.00
X0020:Nos3 UTSW 5 24370124 missense probably damaging 1.00
X0061:Nos3 UTSW 5 24382635 missense probably damaging 0.99
Z1176:Nos3 UTSW 5 24377654 missense probably benign 0.02
Z1177:Nos3 UTSW 5 24383950 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAAGTAAGGGTTCATTTCAAGTCC -3'
(R):5'- CACATCCCCATCAGGAAGTG -3'

Sequencing Primer
(F):5'- TTCAAGTCCAACATGGTGGC -3'
(R):5'- CCATCAGGAAGTGGGGCTACTTAG -3'
Posted On2019-10-17