Incidental Mutation 'R7507:Sepsecs'
ID581839
Institutional Source Beutler Lab
Gene Symbol Sepsecs
Ensembl Gene ENSMUSG00000029173
Gene NameSep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase
SynonymsD5Ertd135e, SLA, SecS
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R7507 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location52640087-52669708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52644055 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 422 (F422L)
Ref Sequence ENSEMBL: ENSMUSP00000031069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031069] [ENSMUST00000126574] [ENSMUST00000150709]
PDB Structure Crystal structure of mouse selenocysteine synthase [X-RAY DIFFRACTION]
Crystal structure of mouse selenocysteine synthase, sodium iodide soak [X-RAY DIFFRACTION]
Crystal structure of mouse selenocysteine synthase, sodium phosphate soak [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000031069
AA Change: F422L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031069
Gene: ENSMUSG00000029173
AA Change: F422L

DomainStartEndE-ValueType
Pfam:SepSecS 61 459 4e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126574
SMART Domains Protein: ENSMUSP00000114413
Gene: ENSMUSG00000029173

DomainStartEndE-ValueType
Pfam:SLA_LP_auto_ag 1 116 5.8e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150709
SMART Domains Protein: ENSMUSP00000115477
Gene: ENSMUSG00000029173

DomainStartEndE-ValueType
PDB:3HL2|D 1 69 4e-39 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The amino acid selenocysteine is the only amino acid that does not have its own tRNA synthetase. Instead, this amino acid is synthesized on its cognate tRNA in a three step process. The protein encoded by this gene catalyzes the third step in the process, the conversion of O-phosphoseryl-tRNA(Sec) to selenocysteinyl-tRNA(Sec).[provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Sepsecs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Sepsecs APN 5 52644060 missense probably benign 0.00
IGL02685:Sepsecs APN 5 52647192 missense probably benign
IGL03033:Sepsecs APN 5 52660676 missense probably damaging 1.00
R1051:Sepsecs UTSW 5 52665356 missense probably damaging 1.00
R1240:Sepsecs UTSW 5 52660679 missense probably damaging 1.00
R2014:Sepsecs UTSW 5 52647624 missense probably benign
R2015:Sepsecs UTSW 5 52647624 missense probably benign
R3855:Sepsecs UTSW 5 52664274 missense probably damaging 1.00
R4687:Sepsecs UTSW 5 52643871 missense probably benign 0.00
R5120:Sepsecs UTSW 5 52660661 missense probably damaging 1.00
R5314:Sepsecs UTSW 5 52647673 missense probably benign 0.01
R5468:Sepsecs UTSW 5 52644014 missense probably damaging 1.00
R6924:Sepsecs UTSW 5 52664304 missense probably benign 0.13
R7002:Sepsecs UTSW 5 52647208 critical splice acceptor site probably null
R7527:Sepsecs UTSW 5 52644051 missense possibly damaging 0.85
R7792:Sepsecs UTSW 5 52644049 missense probably damaging 1.00
R7798:Sepsecs UTSW 5 52647189 missense probably benign
RF003:Sepsecs UTSW 5 52647191 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AATGTCCGCATCTTCAGCTTTG -3'
(R):5'- AGCTGACAGTTTGTTTGCACTG -3'

Sequencing Primer
(F):5'- CATCTTCAGCTTTGTTGCGGTCAG -3'
(R):5'- GCACTGGCCACAATTTATGC -3'
Posted On2019-10-17