Incidental Mutation 'R7507:Rnf216'
ID 581840
Institutional Source Beutler Lab
Gene Symbol Rnf216
Ensembl Gene ENSMUSG00000045078
Gene Name ring finger protein 216
Synonyms 2810055G22Rik, Ubce7ip1, F830018F18Rik, UIP83
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7507 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 142990893-143112994 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 143089802 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 342 (D342E)
Ref Sequence ENSEMBL: ENSMUSP00000143705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053498] [ENSMUST00000197296] [ENSMUST00000200430] [ENSMUST00000200607]
AlphaFold P58283
Predicted Effect probably damaging
Transcript: ENSMUST00000053498
AA Change: D285E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052563
Gene: ENSMUSG00000045078
AA Change: D285E

DomainStartEndE-ValueType
Blast:RING 560 620 4e-6 BLAST
IBR 629 693 6.82e-5 SMART
IBR 702 769 1.79e-1 SMART
low complexity region 786 803 N/A INTRINSIC
low complexity region 842 866 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197296
Predicted Effect probably benign
Transcript: ENSMUST00000200430
Predicted Effect probably damaging
Transcript: ENSMUST00000200607
AA Change: D342E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143705
Gene: ENSMUSG00000045078
AA Change: D342E

DomainStartEndE-ValueType
Blast:RING 560 620 4e-6 BLAST
IBR 629 693 6.82e-5 SMART
IBR 702 769 1.79e-1 SMART
low complexity region 786 803 N/A INTRINSIC
low complexity region 842 866 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which specifically colocalizes and interacts with the serine/threonine protein kinase, receptor-interacting protein (RIP). Zinc finger domains of the encoded protein are required for its interaction with RIP and for inhibition of TNF- and IL1-induced NF-kappa B activation pathways. The encoded protein may also function as an E3 ubiquitin-protein ligase which accepts ubiquitin from E2 ubiquitin-conjugating enzymes and transfers it to substrates. Several alternatively spliced transcript variants have been described for this locus but the full-length natures of only some are known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Rnf216
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02417:Rnf216 APN 5 143068910 missense possibly damaging 0.67
IGL02502:Rnf216 APN 5 143068867 missense probably damaging 1.00
IGL02536:Rnf216 APN 5 143080240 missense probably benign 0.04
IGL03196:Rnf216 APN 5 143081011 missense probably damaging 1.00
PIT4445001:Rnf216 UTSW 5 143086003 missense probably damaging 1.00
R0270:Rnf216 UTSW 5 143080241 missense possibly damaging 0.63
R0422:Rnf216 UTSW 5 143015654 nonsense probably null
R0422:Rnf216 UTSW 5 143090370 missense probably benign 0.15
R0782:Rnf216 UTSW 5 143068892 missense possibly damaging 0.64
R1109:Rnf216 UTSW 5 143068369 missense probably damaging 1.00
R1917:Rnf216 UTSW 5 142992806 missense probably benign 0.03
R2233:Rnf216 UTSW 5 143090926 missense probably benign
R2234:Rnf216 UTSW 5 143090926 missense probably benign
R2235:Rnf216 UTSW 5 143090926 missense probably benign
R2340:Rnf216 UTSW 5 143080334 missense probably damaging 0.99
R3015:Rnf216 UTSW 5 143075725 critical splice donor site probably null
R3726:Rnf216 UTSW 5 143027946 missense probably damaging 0.96
R4231:Rnf216 UTSW 5 143093090 missense probably damaging 1.00
R4885:Rnf216 UTSW 5 143090580 nonsense probably null
R4942:Rnf216 UTSW 5 143093059 missense probably damaging 1.00
R4973:Rnf216 UTSW 5 143090316 missense probably benign
R5291:Rnf216 UTSW 5 143090212 missense probably benign
R5307:Rnf216 UTSW 5 143093002 missense probably damaging 1.00
R5328:Rnf216 UTSW 5 143092999 missense possibly damaging 0.84
R5416:Rnf216 UTSW 5 143015771 nonsense probably null
R5888:Rnf216 UTSW 5 143068314 splice site probably null
R6048:Rnf216 UTSW 5 143068904 missense probably damaging 1.00
R6451:Rnf216 UTSW 5 142992834 missense possibly damaging 0.80
R6595:Rnf216 UTSW 5 143090657 missense probably benign 0.00
R7422:Rnf216 UTSW 5 143090836 missense probably benign 0.01
R7470:Rnf216 UTSW 5 142992725 missense possibly damaging 0.88
R7504:Rnf216 UTSW 5 143075759 missense probably benign 0.27
R7695:Rnf216 UTSW 5 143085904 missense possibly damaging 0.80
R7757:Rnf216 UTSW 5 143080236 missense probably damaging 1.00
R7768:Rnf216 UTSW 5 143098444 start codon destroyed probably null 1.00
R8056:Rnf216 UTSW 5 142992861 missense probably benign 0.02
R8081:Rnf216 UTSW 5 143027964 missense probably damaging 0.98
R8985:Rnf216 UTSW 5 143090425 missense probably benign 0.16
Z1176:Rnf216 UTSW 5 143098443 start codon destroyed probably null 0.99
Z1177:Rnf216 UTSW 5 142992807 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTCTACTTCAGGCCTTTCTTT -3'
(R):5'- CCTCTTGGCTGACCTTTAAGC -3'

Sequencing Primer
(F):5'- CCTTGCTGAAAGAAGTGTGCCAC -3'
(R):5'- GCTGACCTTTAAGCTAGGCACAG -3'
Posted On 2019-10-17