Incidental Mutation 'R7507:Ppp1r12c'
ID581844
Institutional Source Beutler Lab
Gene Symbol Ppp1r12c
Ensembl Gene ENSMUSG00000019254
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 12C
Synonyms2410197A17Rik, Mbs85
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R7507 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location4481520-4501680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4483971 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 521 (A521V)
Ref Sequence ENSEMBL: ENSMUSP00000013886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013886] [ENSMUST00000086372] [ENSMUST00000124248] [ENSMUST00000163137] [ENSMUST00000163893] [ENSMUST00000164987] [ENSMUST00000171445]
Predicted Effect probably benign
Transcript: ENSMUST00000013886
AA Change: A521V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000013886
Gene: ENSMUSG00000019254
AA Change: A521V

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 74 97 N/A INTRINSIC
ANK 104 133 3.71e-4 SMART
ANK 137 166 3.43e-8 SMART
low complexity region 205 210 N/A INTRINSIC
ANK 230 259 7.95e-4 SMART
ANK 263 292 2.41e-3 SMART
low complexity region 369 385 N/A INTRINSIC
low complexity region 401 413 N/A INTRINSIC
internal_repeat_2 450 508 2.86e-5 PROSPERO
internal_repeat_2 545 599 2.86e-5 PROSPERO
low complexity region 631 649 N/A INTRINSIC
Pfam:PRKG1_interact 682 782 9.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086372
SMART Domains Protein: ENSMUSP00000083559
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124248
AA Change: A442V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000120029
Gene: ENSMUSG00000019254
AA Change: A442V

DomainStartEndE-ValueType
ANK 25 54 3.71e-4 SMART
ANK 58 87 3.43e-8 SMART
low complexity region 126 131 N/A INTRINSIC
ANK 151 180 7.95e-4 SMART
ANK 184 213 2.41e-3 SMART
low complexity region 290 306 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:2KJY|A 445 498 3e-11 PDB
low complexity region 553 571 N/A INTRINSIC
coiled coil region 604 704 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163137
SMART Domains Protein: ENSMUSP00000131345
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 100 1.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163893
SMART Domains Protein: ENSMUSP00000125840
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164987
SMART Domains Protein: ENSMUSP00000130665
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
low complexity region 15 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171445
SMART Domains Protein: ENSMUSP00000133206
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 96 226 5.8e-46 PFAM
low complexity region 343 365 N/A INTRINSIC
SH3 541 596 2.62e-11 SMART
low complexity region 615 625 N/A INTRINSIC
PDB:1WWU|A 693 759 1e-19 PDB
low complexity region 762 776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a subunit of myosin phosphatase. The encoded protein regulates the catalytic activity of protein phosphatase 1 delta and assembly of the actin cytoskeleton. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Ppp1r12c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Ppp1r12c APN 7 4497345 splice site probably benign
IGL01419:Ppp1r12c APN 7 4486352 splice site probably null
IGL02126:Ppp1r12c APN 7 4489859 missense probably benign 0.43
IGL03388:Ppp1r12c APN 7 4482070 unclassified probably benign
PIT4418001:Ppp1r12c UTSW 7 4501267 missense probably null 0.09
R0523:Ppp1r12c UTSW 7 4489772 missense probably damaging 1.00
R0815:Ppp1r12c UTSW 7 4486366 missense probably damaging 1.00
R0863:Ppp1r12c UTSW 7 4486366 missense probably damaging 1.00
R1413:Ppp1r12c UTSW 7 4484444 splice site probably null
R1522:Ppp1r12c UTSW 7 4497425 missense probably damaging 1.00
R1835:Ppp1r12c UTSW 7 4483651 missense probably damaging 1.00
R2004:Ppp1r12c UTSW 7 4482975 nonsense probably null
R2170:Ppp1r12c UTSW 7 4482806 missense possibly damaging 0.76
R3787:Ppp1r12c UTSW 7 4486584 missense probably damaging 1.00
R3833:Ppp1r12c UTSW 7 4482786 unclassified probably benign
R4093:Ppp1r12c UTSW 7 4483367 missense probably damaging 0.99
R4095:Ppp1r12c UTSW 7 4483367 missense probably damaging 0.99
R4108:Ppp1r12c UTSW 7 4486566 missense probably damaging 1.00
R5177:Ppp1r12c UTSW 7 4484496 nonsense probably null
R5319:Ppp1r12c UTSW 7 4483984 missense probably benign 0.01
R5561:Ppp1r12c UTSW 7 4486356 critical splice donor site probably null
R5739:Ppp1r12c UTSW 7 4497282 missense probably damaging 1.00
R5837:Ppp1r12c UTSW 7 4497404 intron probably benign
R6531:Ppp1r12c UTSW 7 4482789 critical splice donor site probably null
R7207:Ppp1r12c UTSW 7 4489868 missense probably damaging 1.00
R7920:Ppp1r12c UTSW 7 4483355 missense probably benign 0.00
R7934:Ppp1r12c UTSW 7 4485417 nonsense probably null
R8391:Ppp1r12c UTSW 7 4497432 missense probably damaging 1.00
R8397:Ppp1r12c UTSW 7 4489769 missense probably damaging 0.98
R8793:Ppp1r12c UTSW 7 4482888 missense probably benign
R8851:Ppp1r12c UTSW 7 4484704 missense probably damaging 1.00
Z1177:Ppp1r12c UTSW 7 4484629 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGACACTATAGAAGGGTGCACATC -3'
(R):5'- TCTGTTTGCCCAGAAATGACCC -3'

Sequencing Primer
(F):5'- CTATAGAAGGGTGCACATCCTAGC -3'
(R):5'- ATGACCCCTTTCAGTAGTGACAACTG -3'
Posted On2019-10-17