Incidental Mutation 'R7507:BC051019'
ID581847
Institutional Source Beutler Lab
Gene Symbol BC051019
Ensembl Gene ENSMUSG00000031022
Gene NamecDNA sequence BC051019
SynonymsICRFP703N2430Q5.5, D7H11orf16
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R7507 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location109712181-109723850 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109716268 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 260 (D260V)
Ref Sequence ENSEMBL: ENSMUSP00000033334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033334] [ENSMUST00000033335] [ENSMUST00000106735] [ENSMUST00000145211]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033334
AA Change: D260V

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033334
Gene: ENSMUSG00000031022
AA Change: D260V

DomainStartEndE-ValueType
Pfam:DUF4537 85 225 1.1e-41 PFAM
low complexity region 258 284 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033335
Predicted Effect possibly damaging
Transcript: ENSMUST00000106735
AA Change: D260V

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102346
Gene: ENSMUSG00000031022
AA Change: D260V

DomainStartEndE-ValueType
Pfam:DUF4537 85 225 6.3e-44 PFAM
low complexity region 258 284 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000115006
Gene: ENSMUSG00000031022
AA Change: D112V

DomainStartEndE-ValueType
Pfam:DUF4537 24 77 8.3e-12 PFAM
low complexity region 110 136 N/A INTRINSIC
low complexity region 186 199 N/A INTRINSIC
Meta Mutation Damage Score 0.1407 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in BC051019
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:BC051019 APN 7 109720676 missense probably benign 0.07
IGL02687:BC051019 APN 7 109716352 missense possibly damaging 0.90
IGL02970:BC051019 APN 7 109716055 missense probably benign 0.03
R0494:BC051019 UTSW 7 109717975 missense probably benign 0.29
R0755:BC051019 UTSW 7 109716095 nonsense probably null
R1619:BC051019 UTSW 7 109718062 missense probably damaging 1.00
R1768:BC051019 UTSW 7 109723174 missense probably benign 0.04
R2001:BC051019 UTSW 7 109720551 nonsense probably null
R4059:BC051019 UTSW 7 109717995 nonsense probably null
R4790:BC051019 UTSW 7 109716346 missense probably benign 0.01
R5091:BC051019 UTSW 7 109720582 missense probably null 1.00
R7129:BC051019 UTSW 7 109720618 missense
R7743:BC051019 UTSW 7 109716059 missense probably damaging 0.98
Z1177:BC051019 UTSW 7 109720640 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATATTGTAGCTGAGCTCTGCC -3'
(R):5'- TGGCAAGACAACTAAGGTGCC -3'

Sequencing Primer
(F):5'- CTCCTTAGGACCTTGTAGGGGC -3'
(R):5'- GACAACTAAGGTGCCTCTAGG -3'
Posted On2019-10-17