Incidental Mutation 'R7507:BC051019'
ID 581847
Institutional Source Beutler Lab
Gene Symbol BC051019
Ensembl Gene ENSMUSG00000031022
Gene Name cDNA sequence BC051019
Synonyms ICRFP703N2430Q5.5, D7H11orf16
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock # R7507 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 109712181-109723850 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 109716268 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 260 (D260V)
Ref Sequence ENSEMBL: ENSMUSP00000033334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033334] [ENSMUST00000033335] [ENSMUST00000106735] [ENSMUST00000145211]
AlphaFold Q9JJR6
Predicted Effect possibly damaging
Transcript: ENSMUST00000033334
AA Change: D260V

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033334
Gene: ENSMUSG00000031022
AA Change: D260V

DomainStartEndE-ValueType
Pfam:DUF4537 85 225 1.1e-41 PFAM
low complexity region 258 284 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033335
Predicted Effect possibly damaging
Transcript: ENSMUST00000106735
AA Change: D260V

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102346
Gene: ENSMUSG00000031022
AA Change: D260V

DomainStartEndE-ValueType
Pfam:DUF4537 85 225 6.3e-44 PFAM
low complexity region 258 284 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000115006
Gene: ENSMUSG00000031022
AA Change: D112V

DomainStartEndE-ValueType
Pfam:DUF4537 24 77 8.3e-12 PFAM
low complexity region 110 136 N/A INTRINSIC
low complexity region 186 199 N/A INTRINSIC
Meta Mutation Damage Score 0.1407 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in BC051019
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:BC051019 APN 7 109720676 missense probably benign 0.07
IGL02687:BC051019 APN 7 109716352 missense possibly damaging 0.90
IGL02970:BC051019 APN 7 109716055 missense probably benign 0.03
R0494:BC051019 UTSW 7 109717975 missense probably benign 0.29
R0755:BC051019 UTSW 7 109716095 nonsense probably null
R1619:BC051019 UTSW 7 109718062 missense probably damaging 1.00
R1768:BC051019 UTSW 7 109723174 missense probably benign 0.04
R2001:BC051019 UTSW 7 109720551 nonsense probably null
R4059:BC051019 UTSW 7 109717995 nonsense probably null
R4790:BC051019 UTSW 7 109716346 missense probably benign 0.01
R5091:BC051019 UTSW 7 109720582 missense probably null 1.00
R7129:BC051019 UTSW 7 109720618 missense
R7743:BC051019 UTSW 7 109716059 missense probably damaging 0.98
R8929:BC051019 UTSW 7 109716026 missense probably damaging 0.97
R8931:BC051019 UTSW 7 109716079 missense probably damaging 1.00
R9497:BC051019 UTSW 7 109716259 missense probably damaging 1.00
Z1177:BC051019 UTSW 7 109720640 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATATTGTAGCTGAGCTCTGCC -3'
(R):5'- TGGCAAGACAACTAAGGTGCC -3'

Sequencing Primer
(F):5'- CTCCTTAGGACCTTGTAGGGGC -3'
(R):5'- GACAACTAAGGTGCCTCTAGG -3'
Posted On 2019-10-17