Incidental Mutation 'R7507:Adam8'
ID581848
Institutional Source Beutler Lab
Gene Symbol Adam8
Ensembl Gene ENSMUSG00000025473
Gene Namea disintegrin and metallopeptidase domain 8
SynonymsCD156, MS2, E430039A18Rik, CD156a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7507 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location139978932-139992562 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 139987178 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026546] [ENSMUST00000106069] [ENSMUST00000148670] [ENSMUST00000173209]
Predicted Effect probably null
Transcript: ENSMUST00000026546
SMART Domains Protein: ENSMUSP00000026546
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 151 5.9e-35 PFAM
Pfam:Reprolysin_5 193 371 1e-22 PFAM
Pfam:Reprolysin_4 193 384 1.7e-16 PFAM
Pfam:Reprolysin 195 394 2.7e-70 PFAM
Pfam:Reprolysin_2 214 384 1.6e-16 PFAM
Pfam:Reprolysin_3 218 339 4.9e-21 PFAM
DISIN 411 486 5.16e-36 SMART
ACR 487 606 2.15e-35 SMART
EGF 613 642 3.06e-1 SMART
transmembrane domain 660 682 N/A INTRINSIC
low complexity region 732 762 N/A INTRINSIC
low complexity region 770 783 N/A INTRINSIC
low complexity region 784 812 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106069
SMART Domains Protein: ENSMUSP00000101684
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 152 4e-30 PFAM
Pfam:Reprolysin_5 194 372 9.6e-23 PFAM
Pfam:Reprolysin_4 194 385 1.6e-16 PFAM
Pfam:Reprolysin 196 395 2.2e-73 PFAM
Pfam:Reprolysin_2 215 385 2.9e-18 PFAM
Pfam:Reprolysin_3 219 340 6.6e-21 PFAM
DISIN 412 487 5.16e-36 SMART
ACR 488 607 2.15e-35 SMART
EGF 614 643 3.06e-1 SMART
transmembrane domain 661 683 N/A INTRINSIC
low complexity region 733 763 N/A INTRINSIC
low complexity region 771 784 N/A INTRINSIC
low complexity region 785 813 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000148670
SMART Domains Protein: ENSMUSP00000117858
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 151 1.8e-35 PFAM
Pfam:Reprolysin_5 193 371 3.6e-23 PFAM
Pfam:Reprolysin_4 193 384 6e-17 PFAM
Pfam:Reprolysin 195 394 8.2e-71 PFAM
Pfam:Reprolysin_2 214 384 5.8e-17 PFAM
Pfam:Reprolysin_3 218 339 1.7e-21 PFAM
DISIN 411 486 5.16e-36 SMART
ACR 487 612 2.21e-32 SMART
EGF 619 648 3.06e-1 SMART
transmembrane domain 666 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173209
SMART Domains Protein: ENSMUSP00000133673
Gene: ENSMUSG00000025473

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 31 45 N/A INTRINSIC
Meta Mutation Damage Score 0.9577 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene encodes a member of the Adam family of proteins that contain the disintegrin and metalloprotease domains. The encoded protein is localized to the cell surface, where it is involved in the remodeling of extracellular matrix and cell migration. Mice lacking the encoded protein display persistent inflammation upon treatment with allergens. Alternative splicing of this gene results in multiple variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous mutant mice do not exhibit any morphological or pathological abnormalities. Mice homozygous for a different knock-out allele exhibit reduced osteoclast differentiation and calvarial fibrosis in response to TNF-alpha treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Adam8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Adam8 APN 7 139987245 missense probably damaging 1.00
IGL02044:Adam8 APN 7 139982822 missense possibly damaging 0.85
IGL02228:Adam8 APN 7 139988806 splice site probably null
IGL02257:Adam8 APN 7 139987648 missense possibly damaging 0.88
IGL03101:Adam8 APN 7 139988543 missense possibly damaging 0.56
R0320:Adam8 UTSW 7 139986442 missense probably damaging 1.00
R0384:Adam8 UTSW 7 139986812 unclassified probably benign
R1169:Adam8 UTSW 7 139983929 missense probably benign 0.11
R1340:Adam8 UTSW 7 139991377 missense probably damaging 0.99
R1699:Adam8 UTSW 7 139983311 missense possibly damaging 0.72
R3725:Adam8 UTSW 7 139983868 missense possibly damaging 0.63
R3874:Adam8 UTSW 7 139987607 missense probably damaging 1.00
R4716:Adam8 UTSW 7 139983938 missense probably benign 0.31
R4754:Adam8 UTSW 7 139984780 missense possibly damaging 0.87
R4907:Adam8 UTSW 7 139989373 missense probably benign 0.03
R5345:Adam8 UTSW 7 139987639 missense probably benign 0.03
R5579:Adam8 UTSW 7 139988984 missense probably benign 0.03
R5696:Adam8 UTSW 7 139989246 missense probably benign 0.03
R5805:Adam8 UTSW 7 139985881 missense probably damaging 1.00
R5948:Adam8 UTSW 7 139987884 missense probably benign 0.07
R5991:Adam8 UTSW 7 139990287 missense probably damaging 1.00
R6280:Adam8 UTSW 7 139984807 missense probably damaging 0.99
R6456:Adam8 UTSW 7 139986788 missense possibly damaging 0.96
R7098:Adam8 UTSW 7 139979499 missense possibly damaging 0.53
R7105:Adam8 UTSW 7 139990055 missense probably benign 0.00
R7334:Adam8 UTSW 7 139988990 missense probably damaging 1.00
R7342:Adam8 UTSW 7 139986391 missense probably benign 0.00
R7382:Adam8 UTSW 7 139990107 missense possibly damaging 0.74
R7425:Adam8 UTSW 7 139992481 unclassified probably benign
R7637:Adam8 UTSW 7 139985430 missense probably damaging 0.98
R7904:Adam8 UTSW 7 139987678 missense probably benign 0.17
R8024:Adam8 UTSW 7 139987576 missense probably damaging 1.00
R8176:Adam8 UTSW 7 139988873 missense probably benign 0.03
R8438:Adam8 UTSW 7 139985336 critical splice donor site probably null
R8439:Adam8 UTSW 7 139987849 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GTGCCATTCTGTTGGAAGGC -3'
(R):5'- GGTAAATTAGCTTCGACCCCTTC -3'

Sequencing Primer
(F):5'- AAGGCATCTTCGGGACATG -3'
(R):5'- TTCCCCAGTGATCACCAAAAG -3'
Posted On2019-10-17