Incidental Mutation 'R7507:Sgcz'
ID581849
Institutional Source Beutler Lab
Gene Symbol Sgcz
Ensembl Gene ENSMUSG00000039539
Gene Namesarcoglycan zeta
SynonymsC230085N17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R7507 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location37522298-38661508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37953046 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 17 (E17D)
Ref Sequence ENSEMBL: ENSMUSP00000113912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118896] [ENSMUST00000135764]
Predicted Effect probably benign
Transcript: ENSMUST00000118896
AA Change: E17D

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113912
Gene: ENSMUSG00000039539
AA Change: E17D

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 38 298 4.7e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135764
AA Change: E17D

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117250
Gene: ENSMUSG00000039539
AA Change: E17D

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 38 201 4.4e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zeta-sarcoglycan gene measures over 465 kb and localizes to 8p22. This protein is part of the sarcoglycan complex, a group of 6 proteins. The sarcoglycans are all N-glycosylated transmembrane proteins with a short intra-cellular domain, a single transmembrane region and a large extra-cellular domain containing a carboxyl-terminal cluster with several conserved cysteine residues. The sarcoglycan complex is part of the dystrophin-associated glycoprotein complex (DGC), which bridges the inner cytoskeleton and the extra-cellular matrix. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Sgcz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01966:Sgcz APN 8 37640015 missense probably damaging 1.00
IGL02593:Sgcz APN 8 37523278 missense probably damaging 0.97
IGL03237:Sgcz APN 8 37563178 missense probably benign 0.01
IGL03238:Sgcz APN 8 37563140 critical splice donor site probably null
R0076:Sgcz UTSW 8 37545442 splice site probably benign
R0276:Sgcz UTSW 8 37952919 missense probably benign 0.18
R2095:Sgcz UTSW 8 37540392 splice site probably benign
R3623:Sgcz UTSW 8 37953047 missense probably damaging 0.96
R3624:Sgcz UTSW 8 37953047 missense probably damaging 0.96
R3862:Sgcz UTSW 8 37523411 missense probably benign
R3863:Sgcz UTSW 8 37523411 missense probably benign
R3953:Sgcz UTSW 8 37526192 splice site probably benign
R3956:Sgcz UTSW 8 37526192 splice site probably benign
R5120:Sgcz UTSW 8 37526266 missense probably benign 0.30
R5121:Sgcz UTSW 8 37539667 missense probably damaging 1.00
R5431:Sgcz UTSW 8 37639984 missense probably damaging 0.98
R5913:Sgcz UTSW 8 37526271 missense possibly damaging 0.75
R6921:Sgcz UTSW 8 37526289 missense probably damaging 1.00
R7151:Sgcz UTSW 8 37539679 missense possibly damaging 0.67
R7412:Sgcz UTSW 8 37523411 missense probably benign
R7554:Sgcz UTSW 8 37563272 splice site probably null
R8121:Sgcz UTSW 8 37523303 missense probably damaging 1.00
R8355:Sgcz UTSW 8 37723085 missense probably benign 0.00
R8455:Sgcz UTSW 8 37723085 missense probably benign 0.00
R8486:Sgcz UTSW 8 37723053 missense probably benign 0.01
R8871:Sgcz UTSW 8 37952949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAAAATTGTGGTGGTACTTACC -3'
(R):5'- GCTATGTCAGTAACACAGACAATG -3'

Sequencing Primer
(F):5'- TACCACAGTGAAATTCATAACCTTC -3'
(R):5'- GCAACTTCCTCTCATCCCTCATG -3'
Posted On2019-10-17