Incidental Mutation 'R7507:Hs3st5'
ID581852
Institutional Source Beutler Lab
Gene Symbol Hs3st5
Ensembl Gene ENSMUSG00000044499
Gene Nameheparan sulfate (glucosamine) 3-O-sulfotransferase 5
SynonymsLOC382362, D930005L05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7507 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location36506814-36834397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36833015 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 182 (V182D)
Ref Sequence ENSEMBL: ENSMUSP00000060229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058738] [ENSMUST00000167191] [ENSMUST00000168572]
Predicted Effect probably damaging
Transcript: ENSMUST00000058738
AA Change: V182D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060229
Gene: ENSMUSG00000044499
AA Change: V182D

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Sulfotransfer_1 90 339 5.5e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167191
AA Change: V182D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130778
Gene: ENSMUSG00000044499
AA Change: V182D

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Sulfotransfer_1 90 339 5.5e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168572
AA Change: V182D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129434
Gene: ENSMUSG00000044499
AA Change: V182D

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Sulfotransfer_1 90 339 5.5e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HS3ST5 belongs to a group of heparan sulfate 3-O-sulfotransferases (EC 2.8.2.23) that transfer sulfate from 3-prime-phosphoadenosine 5-prime phosphosulfate (PAPS) to heparan sulfate and heparin (Mochizuki et al., 2003 [PubMed 12740361]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Hs3st5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Hs3st5 APN 10 36832922 missense probably benign 0.02
IGL00913:Hs3st5 APN 10 36832850 missense probably damaging 1.00
IGL01407:Hs3st5 APN 10 36833408 missense probably damaging 1.00
IGL01516:Hs3st5 APN 10 36833051 missense probably damaging 1.00
IGL02396:Hs3st5 APN 10 36828703 start codon destroyed probably benign 0.08
IGL03351:Hs3st5 APN 10 36833323 missense probably damaging 1.00
R0606:Hs3st5 UTSW 10 36832588 missense probably benign 0.00
R1412:Hs3st5 UTSW 10 36832676 missense probably benign 0.02
R1443:Hs3st5 UTSW 10 36833414 missense probably benign 0.35
R1493:Hs3st5 UTSW 10 36832874 missense probably damaging 1.00
R1768:Hs3st5 UTSW 10 36833169 missense probably benign 0.01
R1792:Hs3st5 UTSW 10 36832724 missense probably benign
R1991:Hs3st5 UTSW 10 36832886 missense probably damaging 1.00
R1992:Hs3st5 UTSW 10 36832886 missense probably damaging 1.00
R4330:Hs3st5 UTSW 10 36832730 missense probably benign 0.06
R4610:Hs3st5 UTSW 10 36828806 missense probably benign 0.26
R5459:Hs3st5 UTSW 10 36828746 missense possibly damaging 0.85
R5561:Hs3st5 UTSW 10 36833429 missense probably damaging 1.00
R6005:Hs3st5 UTSW 10 36832928 missense probably damaging 1.00
R7082:Hs3st5 UTSW 10 36832837 missense probably benign 0.01
R7326:Hs3st5 UTSW 10 36833194 missense probably damaging 1.00
R7885:Hs3st5 UTSW 10 36828780 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCATCCTGCAGTGGTCAAAG -3'
(R):5'- AAGTATTTCAACCAGCGCTCCAG -3'

Sequencing Primer
(F):5'- TGCAGTGGTCAAAGCTTCC -3'
(R):5'- AACCAGCGCTCCAGATGTTTTG -3'
Posted On2019-10-17