Incidental Mutation 'R7507:Clint1'
ID581855
Institutional Source Beutler Lab
Gene Symbol Clint1
Ensembl Gene ENSMUSG00000006169
Gene Nameclathrin interactor 1
SynonymsC530049I24Rik, Epn4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock #R7507 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location45852051-45910625 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45908949 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 512 (Q512K)
Ref Sequence ENSEMBL: ENSMUSP00000104883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109260] [ENSMUST00000109261]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109260
AA Change: Q512K

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104883
Gene: ENSMUSG00000006169
AA Change: Q512K

DomainStartEndE-ValueType
ENTH 22 149 2.56e-61 SMART
low complexity region 262 279 N/A INTRINSIC
low complexity region 311 323 N/A INTRINSIC
low complexity region 332 357 N/A INTRINSIC
low complexity region 427 438 N/A INTRINSIC
low complexity region 540 563 N/A INTRINSIC
low complexity region 569 607 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109261
AA Change: Q530K

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104884
Gene: ENSMUSG00000006169
AA Change: Q530K

DomainStartEndE-ValueType
ENTH 22 149 2.56e-61 SMART
low complexity region 262 279 N/A INTRINSIC
low complexity region 311 323 N/A INTRINSIC
low complexity region 332 357 N/A INTRINSIC
low complexity region 427 438 N/A INTRINSIC
low complexity region 558 581 N/A INTRINSIC
low complexity region 587 625 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to the epsin family of endocytic adapter proteins. The encoded protein interacts with clathrin, the adapter protein AP-1 and phosphoinositides. This protein may be involved in the formation of clathrin coated vesicles and trafficking between the trans-Golgi network and endosomes. Mutations in this gene are associated with a susceptibility to schizophrenia and psychotic disorders. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Clint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Clint1 APN 11 45909019 missense probably benign 0.20
IGL01974:Clint1 APN 11 45909035 missense probably benign 0.24
IGL02312:Clint1 APN 11 45894056 missense probably damaging 1.00
R1440:Clint1 UTSW 11 45890783 missense probably damaging 1.00
R1720:Clint1 UTSW 11 45887410 missense probably damaging 0.99
R1722:Clint1 UTSW 11 45906406 missense possibly damaging 0.68
R1736:Clint1 UTSW 11 45906177 splice site probably null
R2012:Clint1 UTSW 11 45894092 missense possibly damaging 0.77
R2334:Clint1 UTSW 11 45909028 missense probably damaging 0.97
R5260:Clint1 UTSW 11 45907942 missense probably damaging 1.00
R5413:Clint1 UTSW 11 45886480 missense probably damaging 1.00
R6331:Clint1 UTSW 11 45895081 missense probably benign 0.14
R7343:Clint1 UTSW 11 45883763 missense probably damaging 1.00
R8045:Clint1 UTSW 11 45890739 missense not run
X0005:Clint1 UTSW 11 45906430 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGGTAGACCCTGACTGTGG -3'
(R):5'- CACAGTTCCAGAAGGCATGG -3'

Sequencing Primer
(F):5'- AGACCCTGACTGTGGACCATTTATTG -3'
(R):5'- TTCCCATGGTGCCCGACAAG -3'
Posted On2019-10-17