Incidental Mutation 'R7507:Gosr1'
ID581858
Institutional Source Beutler Lab
Gene Symbol Gosr1
Ensembl Gene ENSMUSG00000010392
Gene Namegolgi SNAP receptor complex member 1
SynonymsGOS-28, Cis-Golgi SNARE, GS28
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R7507 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location76726602-76763579 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76754414 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 101 (N101K)
Ref Sequence ENSEMBL: ENSMUSP00000010536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010536]
Predicted Effect probably benign
Transcript: ENSMUST00000010536
AA Change: N101K

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000010536
Gene: ENSMUSG00000010392
AA Change: N101K

DomainStartEndE-ValueType
Pfam:V-SNARE_C 161 226 1.9e-25 PFAM
transmembrane domain 230 249 N/A INTRINSIC
Meta Mutation Damage Score 0.1387 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a trafficking membrane protein which transports proteins among the endoplasmic reticulum and the Golgi and between Golgi compartments. This protein is considered an essential component of the Golgi SNAP receptor (SNARE) complex. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Gosr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01713:Gosr1 APN 11 76754756 missense probably benign 0.34
IGL02640:Gosr1 APN 11 76754777 missense probably benign 0.01
IGL02686:Gosr1 APN 11 76750862 missense probably benign 0.00
IGL02939:Gosr1 APN 11 76750906 splice site probably benign
IGL03325:Gosr1 APN 11 76754403 missense probably benign 0.04
R0743:Gosr1 UTSW 11 76730146 missense probably benign
R0884:Gosr1 UTSW 11 76730146 missense probably benign
R1712:Gosr1 UTSW 11 76750878 missense possibly damaging 0.58
R2064:Gosr1 UTSW 11 76737398 missense probably benign 0.00
R4403:Gosr1 UTSW 11 76754735 missense possibly damaging 0.77
R4919:Gosr1 UTSW 11 76734566 splice site probably null
R7342:Gosr1 UTSW 11 76730207 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTTGCCTTCCAATCTATACATCTGT -3'
(R):5'- TAATGGCAGCCATCCAAATTGT -3'

Sequencing Primer
(F):5'- ACCACAGTTAGCTACTCC -3'
(R):5'- TGGCAGCCATCCAAATTGTAACATG -3'
Posted On2019-10-17