Incidental Mutation 'R7507:Utp6'
ID581859
Institutional Source Beutler Lab
Gene Symbol Utp6
Ensembl Gene ENSMUSG00000035575
Gene NameUTP6 small subunit processome component
SynonymsHCA66, 4732497O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R7507 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location79932321-79962390 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79942186 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 444 (S444P)
Ref Sequence ENSEMBL: ENSMUSP00000046643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043152] [ENSMUST00000108241]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043152
AA Change: S444P

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046643
Gene: ENSMUSG00000035575
AA Change: S444P

DomainStartEndE-ValueType
Blast:HAT 25 63 5e-11 BLAST
HAT 87 119 6.33e2 SMART
HAT 121 153 5.54e-1 SMART
HAT 156 188 2.41e-1 SMART
HAT 305 336 4.13e0 SMART
Blast:HAT 350 382 1e-11 BLAST
Blast:HAT 418 451 2e-9 BLAST
Blast:HAT 454 487 3e-12 BLAST
HAT 489 521 8.05e0 SMART
HAT 525 558 9.13e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108241
AA Change: S444P

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103876
Gene: ENSMUSG00000035575
AA Change: S444P

DomainStartEndE-ValueType
Blast:HAT 25 63 5e-11 BLAST
HAT 87 119 6.33e2 SMART
HAT 121 153 5.54e-1 SMART
HAT 156 188 2.41e-1 SMART
HAT 305 336 4.13e0 SMART
Blast:HAT 350 382 1e-11 BLAST
Blast:HAT 418 451 2e-9 BLAST
Blast:HAT 454 487 3e-12 BLAST
HAT 489 521 8.05e0 SMART
HAT 525 558 9.13e-2 SMART
Meta Mutation Damage Score 0.3829 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Utp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Utp6 APN 11 79955705 nonsense probably null
IGL02889:Utp6 APN 11 79949070 missense possibly damaging 0.88
IGL03028:Utp6 APN 11 79953624 missense probably damaging 0.99
IGL03040:Utp6 APN 11 79936113 splice site probably benign
IGL03084:Utp6 APN 11 79962216 critical splice donor site probably null
IGL03236:Utp6 APN 11 79960741 splice site probably benign
PIT4382001:Utp6 UTSW 11 79962273 missense probably benign 0.02
R0082:Utp6 UTSW 11 79953631 missense possibly damaging 0.80
R0140:Utp6 UTSW 11 79956725 splice site probably benign
R0962:Utp6 UTSW 11 79941868 splice site probably benign
R1485:Utp6 UTSW 11 79948923 missense probably damaging 1.00
R2376:Utp6 UTSW 11 79955613 missense probably damaging 0.99
R2380:Utp6 UTSW 11 79936005 missense possibly damaging 0.67
R4065:Utp6 UTSW 11 79946247 missense probably damaging 1.00
R5465:Utp6 UTSW 11 79949010 missense probably benign 0.08
R5774:Utp6 UTSW 11 79953598 missense probably benign
R6842:Utp6 UTSW 11 79940949 missense probably benign 0.00
R7793:Utp6 UTSW 11 79937730 missense probably benign 0.00
R8349:Utp6 UTSW 11 79945784 missense probably benign 0.00
R8449:Utp6 UTSW 11 79945784 missense probably benign 0.00
R8856:Utp6 UTSW 11 79951629 missense probably benign 0.12
Z1176:Utp6 UTSW 11 79935962 missense probably damaging 1.00
Z1177:Utp6 UTSW 11 79941909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAACTGGCACCTGTGAC -3'
(R):5'- GATGGCTGATGATGGCTACG -3'

Sequencing Primer
(F):5'- TGGCACCTGTGACAGCTATAATAGC -3'
(R):5'- GCTACGGTTGGGTTCCC -3'
Posted On2019-10-17