Mutagenetix > Incidental Mutation

Incidental Mutation 'R0008:Myo3a'

58186

Institutional Source

Beutler Lab

Gene Symbol

Myo3a

Ensembl Gene

ENSMUSG00000025716

Gene Name

myosin IIIA

Synonyms

9030416P08Rik

MMRRC Submission

038303-MU

Accession Numbers

Genbank: NM_148413; MGI: 2183924

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0008 (G1)

Quality Score

181

Status

Validated

Chromosome

Chromosomal Location

22227503-22618252 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 22579741 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 508 (I508N)

Ref Sequence

ENSEMBL: ENSMUSP00000116185 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000138863]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044749
AA Change: I1446N

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: I1446N

Domain	Start	End	E-Value	Type
S_TKc	29	295	1.62e-91	SMART
MYSc	340	1061	2.07e-252	SMART
IQ	1061	1083	2.88e1	SMART
IQ	1088	1110	9.48e-3	SMART
low complexity region	1153	1169	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
low complexity region	1496	1505	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000138863
AA Change: I508N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000116185
Gene: ENSMUSG00000025716
AA Change: I508N

Domain	Start	End	E-Value	Type
Pfam:Myosin_head	1	110	1.7e-28	PFAM
IQ	123	145	2.88e1	SMART
IQ	150	172	9.48e-3	SMART
low complexity region	215	231	N/A	INTRINSIC
low complexity region	421	431	N/A	INTRINSIC
low complexity region	558	567	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149423

Meta Mutation Damage Score

0.1337

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 94.8%

Validation Efficiency

98% (109/111)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579F01Rik	T	C	3: 138,176,585	K118R	possibly damaging	Het
Adtrp	T	C	13: 41,767,465	T88A	probably damaging	Het
Afap1l1	A	G	18: 61,756,905	S87P	probably benign	Het
Ankrd27	A	G	7: 35,603,700	K196R	probably benign	Het
Apoe	G	A	7: 19,697,080	T79M	probably damaging	Het
Arrdc3	T	A	13: 80,883,892	Y81*	probably null	Het
Arrdc3	T	A	13: 80,891,075	I75N	probably damaging	Het
Asah2	T	A	19: 32,003,731	K629*	probably null	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
C130074G19Rik	A	G	1: 184,882,922	S24P	probably benign	Het
C87436	A	G	6: 86,446,283		probably benign	Het
Calcrl	T	C	2: 84,373,274	D54G	probably benign	Het
Clcn2	T	C	16: 20,710,390	N367S	probably null	Het
Cnot1	G	T	8: 95,761,341	D562E	probably damaging	Het
Commd6	G	A	14: 101,640,273		probably benign	Het
Cox6a2	G	A	7: 128,206,040		probably benign	Het
Cp	T	A	3: 19,968,123	Y230N	probably damaging	Het
Dclre1c	T	C	2: 3,437,995	V64A	probably damaging	Het
Eng	T	C	2: 32,677,680	V110A	probably damaging	Het
Esyt3	T	C	9: 99,338,807	I114M	possibly damaging	Het
Fam83h	A	T	15: 76,003,962	Y509N	probably damaging	Het
Fat2	A	T	11: 55,311,249	L333H	probably damaging	Het
Fbxo21	A	G	5: 118,008,013	N567S	possibly damaging	Het
Fn1	A	T	1: 71,595,720	L1964Q	probably damaging	Het
Fuk	T	C	8: 110,884,233		probably benign	Het
Gorasp1	G	T	9: 119,928,246	S353R	possibly damaging	Het
Grk2	C	T	19: 4,287,234	E646K	probably damaging	Het
Hoxc11	T	C	15: 102,954,962	V146A	probably damaging	Het
Igf2bp2	T	C	16: 22,076,091	T301A	probably benign	Het
Il11	T	C	7: 4,773,659	S111G	probably benign	Het
Ist1	A	T	8: 109,676,786	I273K	probably benign	Het
Kdm2b	G	A	5: 122,881,743	S738L	probably benign	Het
Lrp2	T	A	2: 69,516,551	N784Y	probably benign	Het
Lrp6	T	C	6: 134,485,753	E648G	probably damaging	Het
Mapk15	G	A	15: 75,998,254	E408K	probably benign	Het
Mdn1	T	A	4: 32,718,317	F2191I	possibly damaging	Het
Metrn	C	A	17: 25,796,505	V79F	possibly damaging	Het
Mtbp	T	A	15: 55,586,493		probably benign	Het
Myh11	C	A	16: 14,224,019	Q720H	probably damaging	Het
Nat9	A	T	11: 115,185,115	Y27N	probably damaging	Het
Ncapg2	T	C	12: 116,429,835	F553S	probably damaging	Het
Nipsnap3b	T	A	4: 53,015,112	L53Q	probably damaging	Het
Nlrp3	A	T	11: 59,558,448	H852L	probably benign	Het
Olfr1251	T	A	2: 89,667,084	K267N	probably damaging	Het
Olfr1484	A	G	19: 13,585,876	I191V	probably benign	Het
Olfr1532-ps1	A	G	7: 106,915,019	I274V	probably benign	Het
Olfr594	A	T	7: 103,220,351	D211V	probably damaging	Het
Olfr594	G	A	7: 103,220,377	A220T	probably benign	Het
Olfr720	T	A	14: 14,176,092		probably benign	Het
Pax9	A	G	12: 56,709,743	T289A	probably benign	Het
Pcyt2	A	T	11: 120,615,869	I53N	possibly damaging	Het
Pdlim4	C	T	11: 54,055,049	V327M	probably damaging	Het
Pdzph1	T	A	17: 58,922,761		probably benign	Het
Plekhm2	C	T	4: 141,642,393		probably benign	Het
Ppt1	T	C	4: 122,848,423		probably benign	Het
Prdm1	C	T	10: 44,441,679	E398K	probably damaging	Het
Prep	T	C	10: 45,115,078	V280A	probably benign	Het
Prkdc	T	A	16: 15,708,701		probably benign	Het
Proser3	G	A	7: 30,540,138	R514C	probably damaging	Het
Ptk7	G	A	17: 46,572,762		probably benign	Het
Rbm45	T	C	2: 76,378,398	Y293H	probably damaging	Het
Rnf213	A	C	11: 119,465,052	E4108A	possibly damaging	Het
Sdk2	A	G	11: 113,856,755	L643P	probably damaging	Het
Sec24d	C	A	3: 123,350,876		probably benign	Het
Sh2d3c	C	G	2: 32,753,021	H587D	probably damaging	Het
Slc1a1	G	A	19: 28,901,484	G208S	probably benign	Het
Slc35b4	A	T	6: 34,158,517	Y287N	probably damaging	Het
Slc46a2	T	A	4: 59,914,544	L126F	probably damaging	Het
Slc4a8	T	C	15: 100,800,493	M621T	possibly damaging	Het
Slc9b2	T	A	3: 135,336,508	V516D	possibly damaging	Het
Slco1a6	T	A	6: 142,157,222		probably benign	Het
Sncg	C	T	14: 34,374,538	V15I	probably benign	Het
Srgap2	T	C	1: 131,355,564	T260A	probably damaging	Het
Stk10	T	A	11: 32,587,305		probably benign	Het
Taf5	A	G	19: 47,075,862	S415G	possibly damaging	Het
Tdp1	C	T	12: 99,954,958		probably benign	Het
Tdp2	T	G	13: 24,841,350		probably null	Het
Tgfbi	T	A	13: 56,629,774	I357N	probably benign	Het
Tmem116	A	G	5: 121,495,096	T178A	probably damaging	Het
Tnrc6a	G	A	7: 123,170,394	R469H	probably benign	Het
Top2a	A	T	11: 99,002,903	L1055*	probably null	Het
Tox	T	A	4: 6,842,411	M40L	probably benign	Het
Trib2	A	T	12: 15,809,929	H110Q	probably benign	Het
Trpa1	A	G	1: 14,903,215	I293T	possibly damaging	Het
Trpv2	A	G	11: 62,590,260	Y395C	probably damaging	Het
Ubn2	T	A	6: 38,434,600		probably null	Het
Ubr4	C	T	4: 139,430,176	T2348M	probably damaging	Het
Ubxn4	G	A	1: 128,262,904	E256K	probably benign	Het
Vmn1r33	C	A	6: 66,612,526	G15*	probably null	Het
Vmn1r37	T	A	6: 66,731,785	S95T	probably benign	Het
Vmn2r57	A	G	7: 41,400,652	C558R	probably damaging	Het
Vnn1	T	C	10: 23,898,602		probably null	Het
Vps13c	T	C	9: 67,919,262	V1395A	probably benign	Het
Vwa7	A	G	17: 35,019,805	I290V	probably benign	Het
Wdr93	A	G	7: 79,758,473	E234G	probably damaging	Het
Zfp385b	A	T	2: 77,415,947	S245R	probably benign	Het
Zfp942	A	T	17: 21,928,338	C437S	probably damaging	Het
Zfyve9	T	A	4: 108,718,705	E393V	possibly damaging	Het

Other mutations in Myo3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Myo3a	APN	2	22332473	missense	probably benign	0.42
IGL01307:Myo3a	APN	2	22558289	missense	probably damaging	1.00
IGL01413:Myo3a	APN	2	22297600	missense	probably benign	0.25
IGL01655:Myo3a	APN	2	22423326	missense	probably damaging	1.00
IGL01767:Myo3a	APN	2	22423222	missense	probably damaging	0.96
IGL01803:Myo3a	APN	2	22241115	missense	probably damaging	1.00
IGL01969:Myo3a	APN	2	22297688	missense	probably benign	0.03
IGL02043:Myo3a	APN	2	22399965	missense	probably benign	0.01
IGL02124:Myo3a	APN	2	22577526	missense	probably benign	0.01
IGL02174:Myo3a	APN	2	22332393	missense	probably benign	0.04
IGL02649:Myo3a	APN	2	22323607	missense	probably benign
IGL02976:Myo3a	APN	2	22542452	nonsense	probably null
IGL03328:Myo3a	APN	2	22578198	missense	probably benign	0.02
IGL03376:Myo3a	APN	2	22600074	splice site	probably benign
lose	UTSW	2	22558320	nonsense	probably null
snooze	UTSW	2	22282634	missense	probably damaging	0.99
A5278:Myo3a	UTSW	2	22323653	missense	probably benign	0.27
PIT4445001:Myo3a	UTSW	2	22542415	missense	possibly damaging	0.64
R0099:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0212:Myo3a	UTSW	2	22291848	missense	probably damaging	1.00
R0281:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0282:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0492:Myo3a	UTSW	2	22323636	missense	possibly damaging	0.46
R0498:Myo3a	UTSW	2	22577429	missense	possibly damaging	0.74
R0594:Myo3a	UTSW	2	22544332	splice site	probably benign
R0609:Myo3a	UTSW	2	22333513	missense	probably benign	0.29
R0609:Myo3a	UTSW	2	22396299	missense	possibly damaging	0.95
R0827:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R0968:Myo3a	UTSW	2	22558289	missense	probably damaging	1.00
R1157:Myo3a	UTSW	2	22542414	critical splice acceptor site	probably null
R1301:Myo3a	UTSW	2	22267095	splice site	probably benign
R1352:Myo3a	UTSW	2	22323675	critical splice donor site	probably null
R1443:Myo3a	UTSW	2	22282626	missense	probably damaging	0.99
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1517:Myo3a	UTSW	2	22282634	missense	probably damaging	0.99
R1565:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1712:Myo3a	UTSW	2	22564992	missense	probably damaging	1.00
R1722:Myo3a	UTSW	2	22399827	missense	probably benign	0.03
R1822:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1823:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1824:Myo3a	UTSW	2	22396243	missense	probably benign
R1837:Myo3a	UTSW	2	22577592	missense	possibly damaging	0.76
R1867:Myo3a	UTSW	2	22399846	missense	probably benign	0.00
R1917:Myo3a	UTSW	2	22291922	missense	probably damaging	1.00
R1920:Myo3a	UTSW	2	22564996	missense	probably benign	0.02
R1937:Myo3a	UTSW	2	22396315	missense	probably damaging	1.00
R1954:Myo3a	UTSW	2	22241226	missense	probably damaging	1.00
R1988:Myo3a	UTSW	2	22578128	missense	possibly damaging	0.86
R2091:Myo3a	UTSW	2	22333677	missense	probably damaging	0.99
R2115:Myo3a	UTSW	2	22245531	missense	probably damaging	1.00
R2125:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2126:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2216:Myo3a	UTSW	2	22577771	missense	probably benign	0.00
R2413:Myo3a	UTSW	2	22577912	missense	probably benign	0.00
R2964:Myo3a	UTSW	2	22340256	missense	possibly damaging	0.90
R3196:Myo3a	UTSW	2	22399868	missense	possibly damaging	0.86
R3837:Myo3a	UTSW	2	22565109	splice site	probably benign
R3905:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R3926:Myo3a	UTSW	2	22565041	missense	probably damaging	0.99
R4014:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4015:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4017:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4043:Myo3a	UTSW	2	22333539	splice site	probably benign
R4044:Myo3a	UTSW	2	22577700	missense	probably damaging	0.99
R4057:Myo3a	UTSW	2	22266160	missense	probably benign	0.01
R4192:Myo3a	UTSW	2	22407377	missense	probably damaging	1.00
R4282:Myo3a	UTSW	2	22340278	missense	probably benign	0.14
R4321:Myo3a	UTSW	2	22267155	missense	probably damaging	1.00
R4393:Myo3a	UTSW	2	22577854	missense	probably damaging	0.99
R4398:Myo3a	UTSW	2	22577842	missense	probably benign
R4446:Myo3a	UTSW	2	22600137	missense	probably damaging	1.00
R4685:Myo3a	UTSW	2	22407422	missense	probably damaging	1.00
R5032:Myo3a	UTSW	2	22282602	missense	probably damaging	1.00
R5096:Myo3a	UTSW	2	22574242	missense	probably benign	0.16
R5183:Myo3a	UTSW	2	22578158	missense	probably benign	0.05
R5458:Myo3a	UTSW	2	22245550	missense	probably damaging	1.00
R5502:Myo3a	UTSW	2	22558369	missense	probably damaging	1.00
R5522:Myo3a	UTSW	2	22574341	missense	probably damaging	1.00
R6462:Myo3a	UTSW	2	22558411	missense	probably damaging	1.00
R6479:Myo3a	UTSW	2	22577865	missense	probably benign	0.00
R6513:Myo3a	UTSW	2	22407332	missense	probably damaging	1.00
R6520:Myo3a	UTSW	2	22399926	missense	possibly damaging	0.90
R6602:Myo3a	UTSW	2	22577787	missense	probably damaging	0.96
R6671:Myo3a	UTSW	2	22294522	missense	probably damaging	1.00
R6743:Myo3a	UTSW	2	22361664	missense	probably benign	0.24
R6865:Myo3a	UTSW	2	22574301	missense	probably benign	0.00
R6961:Myo3a	UTSW	2	22245558	missense	probably benign	0.00
R7001:Myo3a	UTSW	2	22332377	missense	probably benign	0.04
R7215:Myo3a	UTSW	2	22245567	missense	possibly damaging	0.78
R7301:Myo3a	UTSW	2	22544466	critical splice donor site	probably null
R7318:Myo3a	UTSW	2	22558320	nonsense	probably null
R7447:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R7456:Myo3a	UTSW	2	22407444	missense	probably benign	0.08
R7528:Myo3a	UTSW	2	22266114	nonsense	probably null
R7731:Myo3a	UTSW	2	22282589	missense	probably damaging	1.00
R7768:Myo3a	UTSW	2	22241143	missense	probably damaging	0.99
R8054:Myo3a	UTSW	2	22574317	missense	probably benign	0.00
R8140:Myo3a	UTSW	2	22407346	missense	probably damaging	1.00
R8143:Myo3a	UTSW	2	22282665	critical splice donor site	probably null
R8346:Myo3a	UTSW	2	22558422	critical splice donor site	probably null
R8421:Myo3a	UTSW	2	22362124	missense	probably benign	0.07
R8495:Myo3a	UTSW	2	22396273	missense	probably damaging	0.96
R8551:Myo3a	UTSW	2	22332466	missense	probably benign	0.00
R8708:Myo3a	UTSW	2	22291796	splice site	probably benign
R8757:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8759:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8779:Myo3a	UTSW	2	22245593	nonsense	probably null
R8828:Myo3a	UTSW	2	22241053	missense	probably benign	0.01
R8910:Myo3a	UTSW	2	22574268	missense	probably benign	0.01
R8916:Myo3a	UTSW	2	22567692	missense	probably damaging	1.00
R8926:Myo3a	UTSW	2	22396263	missense	possibly damaging	0.95
R9028:Myo3a	UTSW	2	22600087	missense	possibly damaging	0.79
R9046:Myo3a	UTSW	2	22558355	missense	probably damaging	0.99
R9120:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R9153:Myo3a	UTSW	2	22399933	missense	probably benign	0.02
R9191:Myo3a	UTSW	2	22579829	missense	probably benign	0.24
R9258:Myo3a	UTSW	2	22577533	missense	possibly damaging	0.60
R9436:Myo3a	UTSW	2	22407424	nonsense	probably null
R9464:Myo3a	UTSW	2	22227572	start gained	probably benign
R9487:Myo3a	UTSW	2	22241051	missense	probably benign
R9719:Myo3a	UTSW	2	22544455	missense	probably benign	0.02
R9799:Myo3a	UTSW	2	22600169	missense	probably damaging	1.00
Z1177:Myo3a	UTSW	2	22618140	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- CCATAAGTGCCAATGCCCGATCTC -3'
(R):5'- GGTAGACCATTGCCTCAAGTCACAG -3'

Sequencing Primer
(F):5'- ATCCCCAGGAATTCAAGGGTTTG -3'
(R):5'- ATCTAAGACACCAAGAGTTTGGC -3'

Posted On

2013-07-11