Mutagenetix > Incidental Mutations

Incidental Mutation 'R7507:Kif2b'

581860

Institutional Source

Beutler Lab

Gene Symbol

Kif2b

Ensembl Gene

ENSMUSG00000046755

Gene Name

kinesin family member 2B

Synonyms

1700063D03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.700) question?

Stock #

R7507 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

91575315-91577558 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 91577443 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 5 (F5L)

Ref Sequence

ENSEMBL: ENSMUSP00000058084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061019]

Predicted Effect

probably benign
Transcript: ENSMUST00000061019
AA Change: F5L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000058084
Gene: ENSMUSG00000046755
AA Change: F5L

Domain	Start	End	E-Value	Type
low complexity region	55	70	N/A	INTRINSIC
low complexity region	90	103	N/A	INTRINSIC
low complexity region	151	176	N/A	INTRINSIC
KISc	211	549	2.34e-134	SMART
low complexity region	588	603	N/A	INTRINSIC
coiled coil region	640	664	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (43/43)

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	T	6: 121,675,218	T1359S	probably benign	Het
Adam8	C	T	7: 139,987,178		probably null	Het
Adnp2	A	G	18: 80,130,853	S114P	probably benign	Het
BC051019	T	A	7: 109,716,268	D260V	possibly damaging	Het
Btnl10	A	G	11: 58,920,558	T236A	probably benign	Het
Cacna1c	A	T	6: 119,057,239	L109Q		Het
Clint1	C	A	11: 45,908,949	Q512K	possibly damaging	Het
Dopey1	A	G	9: 86,535,949	N1957S	probably benign	Het
Gosr1	A	T	11: 76,754,414	N101K	probably benign	Het
Gria1	A	G	11: 57,228,939	T350A	probably benign	Het
Hs3st5	T	A	10: 36,833,015	V182D	probably damaging	Het
Igkv4-80	G	T	6: 69,016,693	S71R	probably benign	Het
Med1	A	G	11: 98,158,026	L648P	probably damaging	Het
Mgat4a	G	A	1: 37,452,527	L375F	probably damaging	Het
Mlph	A	T	1: 90,927,707		probably benign	Het
Nbeal1	T	C	1: 60,235,467	S346P	probably damaging	Het
Nhlrc2	G	A	19: 56,597,378	V682I	not run	Het
Nos3	T	C	5: 24,372,644	M552T	probably damaging	Het
Olfr1152	T	C	2: 87,868,369	I126T	probably damaging	Het
Olfr1509	A	G	14: 52,450,473	N20S	probably benign	Het
Olfr799	T	A	10: 129,647,497	I123N	probably damaging	Het
Pcdha5	A	T	18: 36,960,856	R139S	probably benign	Het
Pik3r1	G	A	13: 101,708,982	S147L	probably benign	Het
Plppr4	T	A	3: 117,322,105	H701L	possibly damaging	Het
Pnpla1	T	C	17: 28,876,817	Y71H	probably damaging	Het
Ppp1r12c	G	A	7: 4,483,971	A521V	probably benign	Het
Rasgrp3	C	A	17: 75,497,060	D119E	probably damaging	Het
Rnf216	A	T	5: 143,089,802	D342E	probably damaging	Het
Rnpc3	A	T	3: 113,616,761	S294T	probably benign	Het
Sepsecs	A	G	5: 52,644,055	F422L	probably damaging	Het
Sgcz	T	A	8: 37,953,046	E17D	probably benign	Het
Slc2a5	T	C	4: 150,125,650	Y31H	probably damaging	Het
Spag9	A	G	11: 94,068,080	E310G	probably benign	Het
Stat4	A	G	1: 52,078,574	Y288C	probably damaging	Het
Tet1	A	G	10: 62,832,892		probably null	Het
Trim62	A	G	4: 128,896,871	T154A	probably benign	Het
Tubb4a	T	C	17: 57,081,642	D128G	probably damaging	Het
Ube2cbp	G	A	9: 86,422,886	A301V	possibly damaging	Het
Utp6	A	G	11: 79,942,186	S444P	possibly damaging	Het
Vasn	T	C	16: 4,649,481	C431R	probably damaging	Het
Zfp260	T	C	7: 30,104,866	S64P	probably damaging	Het
Zfp451	A	T	1: 33,769,759	M1007K	probably damaging	Het
Zfp606	C	A	7: 12,492,941	Q330K	probably benign	Het

Other mutations in Kif2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:Kif2b	APN	11	91576380	missense	probably damaging	1.00
IGL01459:Kif2b	APN	11	91577023	missense	possibly damaging	0.65
IGL01468:Kif2b	APN	11	91576365	missense	probably damaging	1.00
IGL02897:Kif2b	APN	11	91576219	missense	probably damaging	1.00
R0076:Kif2b	UTSW	11	91575909	missense	probably damaging	1.00
R0488:Kif2b	UTSW	11	91576972	missense	probably benign	0.00
R0524:Kif2b	UTSW	11	91575724	missense	probably benign	0.00
R0549:Kif2b	UTSW	11	91576584	missense	probably damaging	1.00
R0893:Kif2b	UTSW	11	91575594	missense	probably benign	0.16
R1677:Kif2b	UTSW	11	91575972	missense	probably damaging	1.00
R2025:Kif2b	UTSW	11	91577346	missense	probably damaging	0.99
R2185:Kif2b	UTSW	11	91576971	frame shift	probably null
R2290:Kif2b	UTSW	11	91575696	missense	probably benign	0.00
R4697:Kif2b	UTSW	11	91576846	missense	probably benign	0.01
R4785:Kif2b	UTSW	11	91576428	missense	probably benign	0.07
R5429:Kif2b	UTSW	11	91577229	missense	probably benign	0.03
R5555:Kif2b	UTSW	11	91575460	missense	probably benign	0.00
R5652:Kif2b	UTSW	11	91575830	missense	possibly damaging	0.86
R5765:Kif2b	UTSW	11	91577242	missense	probably benign	0.28
R6101:Kif2b	UTSW	11	91575988	missense	probably benign	0.00
R6105:Kif2b	UTSW	11	91575988	missense	probably benign	0.00
R6450:Kif2b	UTSW	11	91576366	missense	probably damaging	0.99
R6862:Kif2b	UTSW	11	91575915	missense	probably damaging	1.00
R7097:Kif2b	UTSW	11	91576824	missense	probably benign	0.00
R7189:Kif2b	UTSW	11	91577137	missense	probably benign	0.01
R7742:Kif2b	UTSW	11	91576585	missense	possibly damaging	0.85
R7818:Kif2b	UTSW	11	91576126	missense	probably damaging	1.00
R7820:Kif2b	UTSW	11	91577274	missense	probably benign	0.01
R7946:Kif2b	UTSW	11	91575745	missense	probably benign	0.00
R8378:Kif2b	UTSW	11	91576375	missense	possibly damaging	0.95
R8442:Kif2b	UTSW	11	91576314	missense	possibly damaging	0.54
Z1176:Kif2b	UTSW	11	91576264	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAGAAGTACAGTCTCCAGTTCG -3'
(R):5'- TCCCTTTGTGACGAAAGGACC -3'

Sequencing Primer
(F):5'- GAAGTACAGTCTCCAGTTCGATCTTC -3'
(R):5'- CTTTGTGACGAAAGGACCCTCAG -3'

Posted On

2019-10-17