Incidental Mutation 'R7507:Pik3r1'
ID 581863
Institutional Source Beutler Lab
Gene Symbol Pik3r1
Ensembl Gene ENSMUSG00000041417
Gene Name phosphoinositide-3-kinase regulatory subunit 1
Synonyms p55alpha, p85alpha, PI3K, p50alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7507 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 101680563-101768217 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 101708982 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 147 (S147L)
Ref Sequence ENSEMBL: ENSMUSP00000056774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055518]
AlphaFold P26450
Predicted Effect probably benign
Transcript: ENSMUST00000055518
AA Change: S147L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056774
Gene: ENSMUSG00000041417
AA Change: S147L

DomainStartEndE-ValueType
SH3 6 78 2.81e-11 SMART
low complexity region 79 99 N/A INTRINSIC
RhoGAP 126 298 1.94e-37 SMART
low complexity region 303 314 N/A INTRINSIC
SH2 331 414 9.96e-28 SMART
Pfam:PI3K_P85_iSH2 431 599 7.8e-67 PFAM
SH2 622 704 7.33e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase phosphorylates the inositol ring of phosphatidylinositol at the 3-prime position. The enzyme comprises a 110 kD catalytic subunit and a regulatory subunit of either 85, 55, or 50 kD. This gene encodes the 85 kD regulatory subunit. Phosphatidylinositol 3-kinase plays an important role in the metabolic actions of insulin, and a mutation in this gene has been associated with insulin resistance. Alternative splicing of this gene results in four transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit perinatal lethality associated with hepatic necrosis, chylous ascites, enlarged muscle fibers, calcification of cardiac tissue, and hypoglycemia. Mutants lacking only the major isoform are immunodeficient. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Btnl10 A G 11: 58,920,558 T236A probably benign Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Pik3r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Pik3r1 APN 13 101690536 start codon destroyed probably benign
IGL00484:Pik3r1 APN 13 101701747 missense probably benign 0.08
IGL00911:Pik3r1 APN 13 101757661 utr 5 prime probably benign
IGL01620:Pik3r1 APN 13 101686220 missense probably damaging 1.00
IGL01872:Pik3r1 APN 13 101689117 missense probably benign 0.01
IGL02544:Pik3r1 APN 13 101687276 missense probably damaging 1.00
IGL02959:Pik3r1 APN 13 101757529 missense probably benign 0.02
anubis UTSW 13 101702776 nonsense probably null
Astro_boy UTSW 13 101701732 missense probably damaging 1.00
Pennywhistle UTSW 13 101689406 missense probably damaging 0.96
Rocket UTSW 13 101689444 missense probably damaging 1.00
Starburst UTSW 13 101757658 start codon destroyed probably null 0.99
R0635:Pik3r1 UTSW 13 101757418 missense probably benign
R0751:Pik3r1 UTSW 13 101686358 splice site probably null
R0787:Pik3r1 UTSW 13 101690523 missense probably benign 0.30
R0845:Pik3r1 UTSW 13 101686264 missense probably benign 0.45
R0891:Pik3r1 UTSW 13 101701466 missense probably benign
R1066:Pik3r1 UTSW 13 101688663 missense probably damaging 1.00
R1184:Pik3r1 UTSW 13 101686358 splice site probably null
R1735:Pik3r1 UTSW 13 101686374 missense probably damaging 1.00
R2474:Pik3r1 UTSW 13 101702776 nonsense probably null
R3015:Pik3r1 UTSW 13 101687263 missense probably damaging 1.00
R3419:Pik3r1 UTSW 13 101692215 missense probably benign 0.17
R3876:Pik3r1 UTSW 13 101684957 missense probably benign 0.01
R3964:Pik3r1 UTSW 13 101688685 missense possibly damaging 0.75
R4175:Pik3r1 UTSW 13 101701732 missense probably damaging 1.00
R4175:Pik3r1 UTSW 13 101701733 missense probably benign 0.25
R4422:Pik3r1 UTSW 13 101694384 missense probably benign
R4890:Pik3r1 UTSW 13 101757610 missense probably damaging 1.00
R5038:Pik3r1 UTSW 13 101689444 missense probably damaging 1.00
R5117:Pik3r1 UTSW 13 101692236 missense probably benign
R6066:Pik3r1 UTSW 13 101686320 missense possibly damaging 0.72
R6254:Pik3r1 UTSW 13 101689406 missense possibly damaging 0.89
R7421:Pik3r1 UTSW 13 101689136 missense probably damaging 1.00
R7538:Pik3r1 UTSW 13 101689406 missense probably damaging 0.96
R7605:Pik3r1 UTSW 13 101702838 missense probably benign
R7739:Pik3r1 UTSW 13 101709697 missense probably benign 0.01
R8695:Pik3r1 UTSW 13 101757554 missense probably benign 0.40
R9146:Pik3r1 UTSW 13 101688628 splice site probably benign
R9315:Pik3r1 UTSW 13 101757658 start codon destroyed probably null 0.99
R9678:Pik3r1 UTSW 13 101702781 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAACTCCTGCATGTGAGTTG -3'
(R):5'- AGATCCTGCTCTTTAATAGTCCAC -3'

Sequencing Primer
(F):5'- CCTGCATGTGAGTTGGAAATCCC -3'
(R):5'- GCTCTTTAATAGTCCACTGGATTTG -3'
Posted On 2019-10-17